Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MT9647 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027364 | Caenorhabditis elegans | unc-29(e1072) sqv-5(n3039)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. | Heterozygotes are WT and segregate WT, UncSqv and dead eggs. n3039: mid-L4 vulva abnormal, sterile.|"WBStrain mapped, WBPaper00061444 added based on AFP_Strain data." | WBGene00000254(bli-4)|WBGene00005023(sqv-5)|WBGene00006765(unc-29) | WBGene00000254(bli-4), WBGene00005023(sqv-5), WBGene00006765(unc-29) | WB-STRAIN:WBStrain00027364 | WormBase (WB) | WB | available | PMID:9927677 PMID:34040027 |
WB-STRAIN:MT9647, CGC_MT9647 | 2026-08-08 10:13:11 | 0 | ||
|
MT9371 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027361 | Caenorhabditis elegans | nIs50 IV. | nIs50 [mec-7::ced-3a + rol-6(su1006)]. Rollers. | WBGene00003171(mec-7) | WBGene00003171(mec-7) | WB-STRAIN:WBStrain00027361 | WormBase (WB) | WB | available | PMID:8598288 | WB-STRAIN:MT9371, CGC_MT9371 | 2026-08-08 10:13:11 | 0 | ||
|
MT8999 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027355 | Caenorhabditis elegans | unc-42(e270) sqv-4(n2827) V/nT1 [unc-?(n754) let-?] (IV;V). | Hets are Unc (n754) and segregate Unc (n754), Unc(e270)Sqv and dead eggs. n2827: mid-L4 vulva abnormal, sterile.|"Made_by: Ho_yon Hwang" | WBGene00005022(sqv-4)|WBGene00006778(unc-42) | WBGene00005022(sqv-4), WBGene00006778(unc-42) | WB-STRAIN:WBStrain00027355 | WormBase (WB) | WB | available | PMID:9927677 | WB-STRAIN:MT8999, CGC_MT8999 | 2026-08-08 10:13:11 | 0 | ||
|
MT9056 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027356 | Caenorhabditis elegans | nDf20 III; nDp2 [unc-86(e1416)] (III;f). | Segregates Unc-86 animals and dead eggs. | WBGene00006818(unc-86) | WBGene00006818(unc-86) | WB-STRAIN:WBStrain00027356 | WormBase (WB) | WB | available | WB-STRAIN:MT9056, CGC_MT9056 | 2026-08-08 10:13:11 | 0 | |||
|
MT9088 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027357 | Caenorhabditis elegans | sqv-7(n2844) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. | Heterozygotes are WT and segregate WT, UncSqv and DpyUncs. n2844: mid-L4 vulva abnormal, sterile. | WBGene00001072(dpy-10)|WBGene00005025(sqv-7)|WBGene00006744(unc-4)|WBGene00006787(unc-52) | WBGene00001072(dpy-10), WBGene00005025(sqv-7), WBGene00006744(unc-4), WBGene00006787(unc-52) | WB-STRAIN:WBStrain00027357 | WormBase (WB) | WB | available | PMID:9927678 | WB-STRAIN:MT9088, CGC_MT9088 | 2026-08-08 10:13:11 | 0 | ||
|
MT9258 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027358 | Caenorhabditis elegans | ced-7(n2690) III. | EMPTY | WBGene00000421(ced-7) | WBGene00000421(ced-7) | WB-STRAIN:WBStrain00027358 | WormBase (WB) | WB | available | WB-STRAIN:MT9258, CGC_MT9258 | 2026-08-08 10:13:11 | 0 | |||
|
MT8987 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027353 | Caenorhabditis elegans | pag-3(n3098) X. | Kinker Unc, neuronal lineage defects including lineage reiterations and abnormal corpse pattern in ventral cord. Allele causes W113 opal. | WBGene00003909(pag-3) | WBGene00003909(pag-3) | WB-STRAIN:WBStrain00027353 | WormBase (WB) | WB | available | WB-STRAIN:MT8987, CGC_MT8987 | 2026-08-08 10:13:11 | 0 | |||
|
MT8998 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027354 | Caenorhabditis elegans | unc-24(e138) sqv-1(n2819) IV/nT1 [unc-?(n754) let-?] (IV;V). | Heterozygotes are Unc and segregate Uncs, SqvUncs and dead eggs. n2819: mid-L4 vulva abnormal, sterile. | WBGene00005019(sqv-1)|WBGene00006761(unc-24) | WBGene00005019(sqv-1), WBGene00006761(unc-24) | WB-STRAIN:WBStrain00027354 | WormBase (WB) | WB | available | PMID:9927677 | WB-STRAIN:MT8998, CGC_MT8998 | 2026-08-08 10:13:11 | 0 | ||
|
MT8904 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027350 | Caenorhabditis elegans | lin-17(n3091) I. | Mail tale abnormal. Bivulva. | WBGene00003006(lin-17) | WBGene00003006(lin-17) | WB-STRAIN:WBStrain00027350 | WormBase (WB) | WB | available | PMID:8804313 | WB-STRAIN:MT8904, CGC_MT8904 | 2026-08-08 10:13:11 | 1 | ||
|
MT8879 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027348 | Caenorhabditis elegans | dpl-1(n2994) II. | Synthetic Muv B. | WBGene00001061(dpl-1) | WBGene00001061(dpl-1) | WB-STRAIN:WBStrain00027348 | WormBase (WB) | WB | available | WB-STRAIN:MT8879, CGC_MT8879 | 2026-08-08 10:13:11 | 1 | |||
|
MT8886 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027349 | Caenorhabditis elegans | ced-7(n2094) III. | Unengulfed cell corpses. Strong allele of ced-7.|"WBStrain provided so WBPaper00061198 paper added based on AFP_Strain data." | WBGene00000421(ced-7) | WBGene00000421(ced-7) | WB-STRAIN:WBStrain00027349 | WormBase (WB) | WB | available | PMID:9635425 PMID:33759761 |
WB-STRAIN:MT8886, CGC_MT8886 | 2026-08-08 10:13:11 | 0 | ||
|
MT8839 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027344 | Caenorhabditis elegans | lin-52(n771) III. | Made_by: Ferguson/Jeff Thomas|"synMuv class B." | WBGene00003035(lin-52) | WBGene00003035(lin-52) | WB-STRAIN:WBStrain00027344 | WormBase (WB) | WB | available | PMID:31397537 | WB-STRAIN:MT8839, CGC_MT8839 | 2026-08-08 10:13:11 | 1 | ||
|
MT8841 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027346 | Caenorhabditis elegans | lin-54(n2231) IV. | synMuv class B. | WBGene00003037(lin-54) | WBGene00003037(lin-54) | WB-STRAIN:WBStrain00027346 | WormBase (WB) | WB | available | WB-STRAIN:MT8841, CGC_MT8841 | 2026-08-08 10:13:11 | 2 | |||
|
MT8842 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027347 | Caenorhabditis elegans | lin-56(n2728) II. | synMuv class A. | WBGene00003038(lin-56) | WBGene00003038(lin-56) | WB-STRAIN:WBStrain00027347 | WormBase (WB) | WB | available | WB-STRAIN:MT8842, CGC_MT8842 | 2026-08-08 10:13:11 | 0 | |||
|
MT13015 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027420 | Caenorhabditis elegans | mir-72(n4130) II. | Deletion breakpoints are: CTCTCTGCGGAATTATATCAATTTTCT / ACCAATTCTATA...CAGGTCGAGCACTC / GGACTCCTTCTGTGAAGTGCACCTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"|"Mutagen:UV/TMP" | WBGene00003300(mir-72) | WBGene00003300(mir-72) | WB-STRAIN:WBStrain00027420 | WormBase (WB) | WB | available | WB-STRAIN:MT13015, CGC_MT13015 | 2026-08-08 10:13:12 | 0 | |||
|
MT12989 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027416 | Caenorhabditis elegans | mir-53(n4113) IV. | Deletion breakpoints are: ACTCTATGATGTCCTTCAAAACAACA / TAATTTACGCCAT...CAGAATCGGGAGAAA / TTTATAATAATAGAGAGAGAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"|"Mutagen:UV/TMP" | WBGene00003281(mir-53) | WBGene00003281(mir-53) | WB-STRAIN:WBStrain00027416 | WormBase (WB) | WB | available | WB-STRAIN:MT12989, CGC_MT12989 | 2026-08-08 10:13:12 | 0 | |||
|
MT12960 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027411 | Caenorhabditis elegans | epc-1(n4076) III/eT1 (III;V). | Heterozygotes are WT and segregate WT, Uncs, Ste/Mel, and dead eggs. The epc-1(n4076) deletion removes 886 nucleotides from the epc-1 locus (Y111B2A.11). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 2014 and ends at about nt. 2899 to give the junction sequence CTTCTCTGT/CCGGCTTTA.|"Mutagen:UV/TMP" | WBGene00007030(epc-1) | WBGene00007030(epc-1) | WB-STRAIN:WBStrain00027411 | WormBase (WB) | WB | available | WB-STRAIN:MT12960, CGC_MT12960 | 2026-08-08 10:13:12 | 0 | |||
|
MT14910 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027494 | Caenorhabditis elegans | pyp-1(n4599) IV/nT1 [qIs51] (IV;V). | n4599: C47E12.4 deletion from AA12F3. | WBGene00008149(pyp-1) | WBGene00008149(pyp-1) | WB-STRAIN:WBStrain00027494 | WormBase (WB) | WB | available | WB-STRAIN:MT14910, CGC_MT14910 | 2026-08-08 10:13:13 | 0 | |||
|
MT14911 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027495 | Caenorhabditis elegans | set-4(n4600) II. | C32D5.5 deletion allele. | WBGene00016313(set-4) | WBGene00016313(set-4) | WB-STRAIN:WBStrain00027495 | WormBase (WB) | WB | available | WB-STRAIN:MT14911, CGC_MT14911 | 2026-08-08 10:13:13 | 0 | |||
|
MT14919 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027496 | Caenorhabditis elegans | mir-260(n4601) II. | Deletion breakpoints are:TTACTAAAAAAAAAGTGCCTAG / GATTGTCTGAAAATT...CGGCTGAAAAATAT / AAATTTATAACTGGGCAACAGAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects|"Deletion breakpoints are:TTACTAAAAAAAAAGTGCCTAG / GATTGTCTGAAAATT...CGGCTGAAAAATAT / AAATTTATAACTGGGCAACAGAAA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects"|"Made_by: Horvitz Lab" | WBGene00003354(mir-260) | WBGene00003354(mir-260) | WB-STRAIN:WBStrain00027496 | WormBase (WB) | WB | available | WB-STRAIN:MT14919, CGC_MT14919 | 2026-08-08 10:13:13 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
