Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00027473
Source Database: WormBase (WB)
Affected Genes: WBGene00001175(egl-6)
Genomic Alteration: WBGene00001175(egl-6)
Availability: available
Source References: PMID:37769660
Synonyms: egl-6(n4537) X.
Alternate IDs: WB-STRAIN:MT14666, CGC_MT14666
Notes: 2201 bp deletion in C46F4.1. Reference: Ringstad N, Horvitz HR. Nat Neurosci. 2008 Oct;11(10):1168-76.|"Supplementary_genotype egl-6(n4537lf)"
Proper citation: RRID:WB-STRAIN:WBStrain00027473 Copy
http://www.wormbase.org/db/get?name=WBStrain00027470
Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00011729(set-16)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00011729(set-16)
Availability: available
Source References: EMPTY
Synonyms: set-16(n4526)/qC1 [dpy-19(e1259) glp-1(q339)] III.
Alternate IDs: WB-STRAIN:MT14615, CGC_MT14615
Notes: Mutagen:UV/TMP|"T12D8.1 deletion. Putative HMTase-encoding gene, from F21E9 (2001 library). Heterozygotes are WT, and segregate Dpy Steriles (qC1 homozygotes) and larval lethals (set-16 homozygotes)."
Proper citation: RRID:WB-STRAIN:WBStrain00027470 Copy
http://www.wormbase.org/db/get?name=WBStrain00027471
Source Database: WormBase (WB)
Affected Genes: WBGene00003358(mir-265)
Genomic Alteration: WBGene00003358(mir-265)
Availability: available
Source References: EMPTY
Synonyms: mir-265(n4534) IV.
Alternate IDs: WB-STRAIN:MT14661, CGC_MT14661
Notes: Deletion breakpoints are:ACTTTCGAAAAATTTTGCCAT / GTTTTCCAATTT...TATTATTTTCAGAAA / GCCAAAATATTTCTAAATTCCTATATAAATTTCAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:ACTTTCGAAAAATTTTGCCAT / GTTTTCCAATTT...TATTATTTTCAGAAA / GCCAAAATATTTCTAAATTCCTATATAAATTTCAAA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00027471 Copy
http://www.wormbase.org/db/get?name=WBStrain00027469
Source Database: WormBase (WB)
Affected Genes: WBGene00003327(mir-234)
Genomic Alteration: WBGene00003327(mir-234)
Availability: available
Source References: EMPTY
Synonyms: mir-234(n4520) II.
Alternate IDs: WB-STRAIN:MT14588, CGC_MT14588
Notes: Deletion breakpoints are:CAACGTTTCCAAACTGT / AACGTAAATATACAACAC...TGATGGGGGGGGGGGGTCAAGGAAA / GAAGAAAAGGGAAGAAAGAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:CAACGTTTCCAAACTGT / AACGTAAATATACAACAC...TGATGGGGGGGGGGGGTCAAGGAAA / GAAGAAAAGGGAAGAAAGAA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00027469 Copy
http://www.wormbase.org/db/get?name=WBStrain00027467
Source Database: WormBase (WB)
Affected Genes: WBGene00004179(prg-2)
Genomic Alteration: WBGene00004179(prg-2)
Availability: available
Source References: EMPTY
Synonyms: prg-2(nDf57) IV.
Alternate IDs: WB-STRAIN:MT14531, CGC_MT14531
Notes: Deletion breakpoints: ATCGGGATGAAGTTTGCAAA
Proper citation: RRID:WB-STRAIN:WBStrain00027467 Copy
http://www.wormbase.org/db/get?name=WBStrain00027500
Source Database: WormBase (WB)
Affected Genes: WBGene00006600(tph-1)
Genomic Alteration: WBGene00006600(tph-1)
Availability: available
Source References: PMID:33007049, PMID:36653384, PMID:37155851, PMID:38302462, PMID:38555276
Synonyms: tph-1(n4622) II.
Alternate IDs: WB-STRAIN:MT14984, CGC_MT14984
Notes: Egl. Reduced pharyngeal pumping.|"Made_by: Dan Omura"|"WBStrain provided so WBPaper00060405 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00027500 Copy
http://www.wormbase.org/db/get?name=WBStrain00027468
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)
Genomic Alteration: WBGene00001072(dpy-10)
Availability: available
Source References: EMPTY
Synonyms: nDf50 nDf49/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:MT14533, CGC_MT14533
Notes: Homozygous Emb deletion chromosome balanced by GFP and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP nDf50 nDf49 homozygotes (arrest as late embryos). Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Curr Bio (2010) 20:367-73.|"Made_by: Ezequiel Alvarez-Saa"
Proper citation: RRID:WB-STRAIN:WBStrain00027468 Copy
http://www.wormbase.org/db/get?name=WBStrain00027501
Source Database: WormBase (WB)
Affected Genes: WBGene00003274(mir-46)|WBGene00003275(mir-47)
Genomic Alteration: WBGene00003274(mir-46), WBGene00003275(mir-47)
Availability: available
Source References: EMPTY
Synonyms: mir-46(n4475) III; mir-47(gk167) X.
Alternate IDs: WB-STRAIN:MT14993, CGC_MT14993
Notes: Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00027501 Copy
http://www.wormbase.org/db/get?name=WBStrain00027539
Source Database: WormBase (WB)
Affected Genes: WBGene00003338(mir-244)
Genomic Alteration: WBGene00003338(mir-244)
Availability: available
Source References: EMPTY
Synonyms: mir-244(n4367) I.
Alternate IDs: WB-STRAIN:MT16033, CGC_MT16033
Notes: Deletion breakpoints are: CTCGGCAATTGGCGATATTCGGCAATT / CCGGCAACCT...AAAAATACACA / AAAAAGTGAAAATTTAAAAAAATCCACAGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"
Proper citation: RRID:WB-STRAIN:WBStrain00027539 Copy
http://www.wormbase.org/db/get?name=WBStrain00027531
Source Database: WormBase (WB)
Affected Genes: WBGene00002169(isw-1)
Genomic Alteration: WBGene00002169(isw-1)
Availability: available
Source References: PMID:31397537, PMID:38190406
Synonyms: isw-1(n3294) III.
Alternate IDs: WB-STRAIN:MT15795, CGC_MT15795
Notes: Wild type vulva; semi-sterile. Suppressor of lin-53(n833) and lin-15(n767).
Proper citation: RRID:WB-STRAIN:WBStrain00027531 Copy
http://www.wormbase.org/db/get?name=WBStrain00027532
Source Database: WormBase (WB)
Affected Genes: WBGene00003334(mir-240)
Genomic Alteration: WBGene00003334(mir-240)
Availability: available
Source References: EMPTY
Synonyms: mir-240(n4541) X.
Alternate IDs: WB-STRAIN:MT15873, CGC_MT15873
Notes: Deletion breakpoints are:TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00027532 Copy
http://www.wormbase.org/db/get?name=WBStrain00027533
Source Database: WormBase (WB)
Affected Genes: WBGene00000820(csp-2)
Genomic Alteration: WBGene00000820(csp-2)
Availability: available
Source References: EMPTY
Synonyms: csp-2(n4871) IV.
Alternate IDs: WB-STRAIN:MT15883, CGC_MT15883
Notes: n4871 is a 1136 bp deletion that removes the last five exons, including the putative protease active site. Reference: Denning DP, et al. PLoS Genet. 2013;9(3):e1003341.
Proper citation: RRID:WB-STRAIN:WBStrain00027533 Copy
http://www.wormbase.org/db/get?name=WBStrain00027530
Source Database: WormBase (WB)
Affected Genes: WBGene00043991(mir-258.2)
Genomic Alteration: WBGene00043991(mir-258.2)
Availability: available
Source References: EMPTY
Synonyms: mir-258.2(n4797) X.
Alternate IDs: WB-STRAIN:MT15767, CGC_MT15767
Notes: Deletion breakpoints are:ATCAAAGTGAACAAATACG / TGCTCTTCTCCATAACCAAC...CGGCGAATTCCTTATGATTTG / GTCTCTCTTTTGTAGTATGAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:ATCAAAGTGAACAAATACG / TGCTCTTCTCCATAACCAAC...CGGCGAATTCCTTATGATTTG / GTCTCTCTTTTGTAGTATGAAT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00027530 Copy
http://www.wormbase.org/db/get?name=WBStrain00027528
Source Database: WormBase (WB)
Affected Genes: WBGene00021661(mbtr-1)
Genomic Alteration: WBGene00021661(mbtr-1)
Availability: available
Source References: EMPTY
Synonyms: mbtr-1(n4775) I.
Alternate IDs: WB-STRAIN:MT15643, CGC_MT15643
Notes: WT phenotype. From Horvitz 2002 deletion library; deletion removes exons 4, 5, and 6 causing a frame shift after amino acid 165. This should remove last three MBT repeats. Y48G1A.6.
Proper citation: RRID:WB-STRAIN:WBStrain00027528 Copy
http://www.wormbase.org/db/get?name=WBStrain00027529
Source Database: WormBase (WB)
Affected Genes: WBGene00000455(ceh-34)
Genomic Alteration: WBGene00000455(ceh-34)
Availability: available
Source References: EMPTY
Synonyms: nIs175 IV; ceh-34(4796) V.
Alternate IDs: WB-STRAIN:MT15695, CGC_MT15695
Notes: nIs175 [ceh-28p::4xNLS::GFP + lin-15(+)] IV. Extra GFP+ M4 observed in nIs175. Reference: Takashi H, et al. PNAS 2010 Aug 31;107(35):15479-84.
Proper citation: RRID:WB-STRAIN:WBStrain00027529 Copy
http://www.wormbase.org/db/get?name=WBStrain00027524
Source Database: WormBase (WB)
Affected Genes: WBGene00003004(lin-15)|WBGene00003037(lin-54)|WBGene00006766(unc-30)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00003004(lin-15), WBGene00003037(lin-54), WBGene00006766(unc-30), WBGene00023498(lin-15A)
Availability: available
Source References: EMPTY
Synonyms: unc-30(e191) lin-54(n3423) IV/nT1 [qIs51] (IV;V); lin-15A(n767) X.
Alternate IDs: WB-STRAIN:MT15537, CGC_MT15537
Notes: Heterozygotes are Muv and GFP+ and segregate SteUncMuv GFP- and dead eggs. n3423 is PVul and sterile when alone; Muv in synMuv class A background.
Proper citation: RRID:WB-STRAIN:WBStrain00027524 Copy
http://www.wormbase.org/db/get?name=WBStrain00027525
Source Database: WormBase (WB)
Affected Genes: WBGene00003286(mir-58.1)
Genomic Alteration: WBGene00003286(mir-58.1)
Availability: available
Source References: EMPTY
Synonyms: nDf53 III; mir-58.1(n4640) IV; nDf54 X.
Alternate IDs: WB-STRAIN:MT15563, CGC_MT15563
Notes: Made_by: Horvitz Lab|"Sick strain. mir-80 and mir-227 are deleted in nDf53. mir-81, mir-82, T02D1.2 are deleted in nDf54. Deletion breakpoints for n4640 are:CCGGCCAAATCTAGAACTGC / AAGAGTACGGTCTTG...GACTGAGCTAGAGTG / ACCTCTGATAATACGGAACGG. Deletion breakpoints for nDf53 are: ACTCATTTCGTTCGCCAGAAATTC / TCAGTTTGTGTA...ATAGCAGAGGT / ATTAGGAGAGTATAGACATCGAAAGCA. Deletion breakpoints for nDf54 are AAAATTTTTAAATTCTGAAATTAG / TTAAAAAACTGG...ATGAGTGGCAAA / AACTGATTGTGAGTAATTGTCATCTTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."
Proper citation: RRID:WB-STRAIN:WBStrain00027525 Copy
http://www.wormbase.org/db/get?name=WBStrain00027522
Source Database: WormBase (WB)
Affected Genes: WBGene00003311(mir-83)
Genomic Alteration: WBGene00003311(mir-83)
Availability: available
Source References: EMPTY
Synonyms: mir-83(n4638) IV.
Alternate IDs: WB-STRAIN:MT15501, CGC_MT15501
Notes: Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00027522 Copy
http://www.wormbase.org/db/get?name=WBStrain00027560
Source Database: WormBase (WB)
Affected Genes: WBGene00003348(mir-254)
Genomic Alteration: WBGene00003348(mir-254)
Availability: available
Source References: EMPTY
Synonyms: mir-254(n4470) X.
Alternate IDs: WB-STRAIN:MT16506, CGC_MT16506
Notes: Deletion breakpoints are: AAAATTTATTGAATTTTT / ATGAAGAATTACTATAAT...TCCAGGAGTGCAGTACGA / TCTCGAACCATGTTTTCC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"
Proper citation: RRID:WB-STRAIN:WBStrain00027560 Copy
http://www.wormbase.org/db/get?name=WBStrain00027563
Source Database: WormBase (WB)
Affected Genes: WBGene00003041(lin-61)|WBGene00013006(lin-38)
Genomic Alteration: WBGene00003041(lin-61), WBGene00013006(lin-38)
Availability: available
Source References: EMPTY
Synonyms: lin-61(n3447) I; lin-38(n751) II.
Alternate IDs: WB-STRAIN:MT16532, CGC_MT16532
Notes: Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
Proper citation: RRID:WB-STRAIN:WBStrain00027563 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
