Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00027601
Source Database: WormBase (WB)
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Source References: EMPTY
Synonyms: lin-15B&lin-15A(n765) X; nIs407.
Alternate IDs: WB-STRAIN:MT19635, CGC_MT19635
Notes: Mutagen:Gamma|"nIs407 [hlh-2::GFP + lin-15(+)]. Reference: Nakano S, Ellis RE, Horvitz HR. Development. 2010 Dec;137(23):4017-27."
Proper citation: RRID:WB-STRAIN:WBStrain00027601 Copy
http://www.wormbase.org/db/get?name=WBStrain00027564
Source Database: WormBase (WB)
Affected Genes: WBGene00003338(mir-244)
Genomic Alteration: WBGene00003338(mir-244)
Availability: available
Source References: EMPTY
Synonyms: mir-244(n4367) I.
Alternate IDs: WB-STRAIN:MT16696, CGC_MT16696
Notes: Deletion breakpoints are:CTCGGCAATTGGCGATATTCGGCAATT / CCGGCAACCT...AAAAATACACA / AAAAAGTGAAAATTTAAAAAAATCCACAGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:CTCGGCAATTGGCGATATTCGGCAATT / CCGGCAACCT...AAAAATACACA / AAAAAGTGAAAATTTAAAAAAATCCACAGCA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00027564 Copy
http://www.wormbase.org/db/get?name=WBStrain00027565
Source Database: WormBase (WB)
Affected Genes: WBGene00003350(mir-256)
Genomic Alteration: WBGene00003350(mir-256)
Availability: available
Source References: EMPTY
Synonyms: mir-256(n4471) V.
Alternate IDs: WB-STRAIN:MT16762, CGC_MT16762
Notes: Complete deletion allele of mir-256 from bases 5826-6853 on T07H8. This mutation likely has a polar effect on mec-1, which starts at 6924 on T07H8 (the deletion covers putative promoter elements).
Proper citation: RRID:WB-STRAIN:WBStrain00027565 Copy
http://www.wormbase.org/db/get?name=WBStrain00027566
Source Database: WormBase (WB)
Affected Genes: WBGene00000819(csp-1)
Genomic Alteration: WBGene00000819(csp-1)
Availability: available
Source References: EMPTY
Synonyms: csp-1(n4967) II.
Alternate IDs: WB-STRAIN:MT16846, CGC_MT16846
Notes: Mutagen:UV/TMP|"n4967 is a 769 bp deletion that removes the putative protease active site. Reference: Denning DP, et al. PLoS Genet. 2013;9(3):e1003341."
Proper citation: RRID:WB-STRAIN:WBStrain00027566 Copy
http://www.wormbase.org/db/get?name=WBStrain00027600
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: nIs396 V.
Alternate IDs: WB-STRAIN:MT19454, CGC_MT19454
Notes: Mutagen:Gamma radiation|"nIs396 [sams-5 3'::4xNLS-GFP + lin-15(+)] V. GFP expression in MI. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27"
Proper citation: RRID:WB-STRAIN:WBStrain00027600 Copy
http://www.wormbase.org/db/get?name=WBStrain00027518
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: nDf62 X.
Alternate IDs: WB-STRAIN:MT15312, CGC_MT15312
Notes: Made_by: Horvitz Lab|"mir-239a and mir-239b are deleted in nDf62. Deletion breakpoints are:GAGTTTTTAACAGTTTCG / CCACTGGCGCTACTC...AATTGTCGACCAAAAAAAT / CTTGCTATAGTTAAATATTCAATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"mir-239a and mir-239b are deleted in nDf62. Deletion breakpoints are:GAGTTTTTAACAGTTTCG / CCACTGGCGCTACTC...AATTGTCGACCAAAAAAAT / CTTGCTATAGTTAAATATTCAATTT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."
Proper citation: RRID:WB-STRAIN:WBStrain00027518 Copy
http://www.wormbase.org/db/get?name=WBStrain00027516
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00003036(lin-53)
Genomic Alteration: WBGene00000254(bli-4), WBGene00003036(lin-53)
Availability: available
Source References: PMID:31397537
Synonyms: lin-53(n3368) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:MT15107, CGC_MT15107
Notes: Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n3368 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.Class B SynMuv, Ste, Pvul. Reference: Harrison MM, Ceol CJ, Lu X, Horvitz HR. PNAS. 2006 Nov 7;103(45):16782-7.|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027516 Copy
http://www.wormbase.org/db/get?name=WBStrain00027597
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: nIs363 X.
Alternate IDs: WB-STRAIN:MT19110, CGC_MT19110
Notes: Mutagen:Gamma radiation|"nIs363 [D2096.6 (1.7kb UP)::4xNLS-GFP] X. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27"|"nIs363 [D2096.6 (1.7kb UP)::pes-10::4xNLS::GFP + lin-15AB(+)]. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27 [NOTE (Aug 2019): the nIs363 trasngene in this strain was previously described as nIs363 [D2096.6 (1.7kb UP)::4xNLS-GFP] X.]"
Proper citation: RRID:WB-STRAIN:WBStrain00027597 Copy
http://www.wormbase.org/db/get?name=WBStrain00027599
Source Database: WormBase (WB)
Affected Genes: WBGene00012735(sptf-3)
Genomic Alteration: WBGene00012735(sptf-3)
Availability: available
Source References: EMPTY
Synonyms: sptf-3(n4850) I; nIs283 X.
Alternate IDs: WB-STRAIN:MT19372, CGC_MT19372
Notes: nIs283 [gcy-10p::4xNLS::GFP + lin-15(+)]. gcy-10p::4xNLS::GFP is expressed in I1 neurons. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15; 500(7462): 354-358.|"nIs283 [gcy-10p::GFP + lin-15(+)]. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15; 500(7462): 354-358."
Proper citation: RRID:WB-STRAIN:WBStrain00027599 Copy
http://www.wormbase.org/db/get?name=WBStrain00027512
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00006324(sup-17)|WBGene00006765(unc-29)
Genomic Alteration: WBGene00000254(bli-4), WBGene00006324(sup-17), WBGene00006765(unc-29)
Availability: available
Source References: EMPTY
Synonyms: sup-17(n1315) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:MT15081, CGC_MT15081
Notes: Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1315 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
Proper citation: RRID:WB-STRAIN:WBStrain00027512 Copy
http://www.wormbase.org/db/get?name=WBStrain00027593
Source Database: WormBase (WB)
Affected Genes: WBGene00003286(mir-58.1)
Genomic Alteration: WBGene00003286(mir-58.1)
Availability: available
Source References: EMPTY
Synonyms: mir-58.1(n4640) IV; nDf54 X.
Alternate IDs: WB-STRAIN:MT18410, CGC_MT18410
Notes: Made_by: Ezequiel Alvarez-Saa|"Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73."
Proper citation: RRID:WB-STRAIN:WBStrain00027593 Copy
http://www.wormbase.org/db/get?name=WBStrain00027594
Source Database: WormBase (WB)
Affected Genes: WBGene00013808(sfa-1)
Genomic Alteration: WBGene00013808(sfa-1)
Availability: available
Source References: EMPTY
Synonyms: sfa-1(n5223) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:MT18690, CGC_MT18690
Notes: Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP sfa-1 homozygotes (arrest L1-L2 stage). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Ma & Horvitz (2009) PLoS 5(11):e1000708.
Proper citation: RRID:WB-STRAIN:WBStrain00027594 Copy
http://www.wormbase.org/db/get?name=WBStrain00027591
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: nIs289 X.
Alternate IDs: WB-STRAIN:MT18145, CGC_MT18145
Notes: Mutagen:Gamma radiation|"nIs289 [mir-71(+) + sur-5::GFP] X. Rescues mir-71(n4115) lifespan defect. Reference: Boulias K, Horvitz HR. Cell Metab. 2012 Apr 4;15(4):439-50."
Proper citation: RRID:WB-STRAIN:WBStrain00027591 Copy
http://www.wormbase.org/db/get?name=WBStrain00027592
Source Database: WormBase (WB)
Affected Genes: WBGene00003286(mir-58.1)
Genomic Alteration: WBGene00003286(mir-58.1)
Availability: available
Source References: EMPTY
Synonyms: nDf53 III; mir-58.1(n4640) IV.
Alternate IDs: WB-STRAIN:MT18409, CGC_MT18409
Notes: Made_by: Ezequiel Alvarez-Saa|"Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73."
Proper citation: RRID:WB-STRAIN:WBStrain00027592 Copy
http://www.wormbase.org/db/get?name=WBStrain00027506
Source Database: WormBase (WB)
Affected Genes: WBGene00003311(mir-83)
Genomic Alteration: WBGene00003311(mir-83)
Availability: available
Source References: EMPTY
Synonyms: mir-83(n4638) IV.
Alternate IDs: WB-STRAIN:MT15022, CGC_MT15022
Notes: Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00027506 Copy
http://www.wormbase.org/db/get?name=WBStrain00027509
Source Database: WormBase (WB)
Affected Genes: WBGene00003362(mir-269)
Genomic Alteration: WBGene00003362(mir-269)
Availability: available
Source References: EMPTY
Synonyms: mir-269(n4641) IV.
Alternate IDs: WB-STRAIN:MT15025, CGC_MT15025
Notes: Deletion breakpoints are:CCGTTTGCGAGTCGCGGT / GTTGCTCATTGTGCCCGAT...TCCAACTTCTGAC / CCAAGTCAATATTTTTCAGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:CCGTTTGCGAGTCGCGGT / GTTGCTCATTGTGCCCGAT...TCCAACTTCTGAC / CCAAGTCAATATTTTTCAGG.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027509 Copy
http://www.wormbase.org/db/get?name=WBStrain00027503
Source Database: WormBase (WB)
Availability: available
Source References: PMID:38594249
Synonyms: nDf60 V.
Alternate IDs: WB-STRAIN:MT15019, CGC_MT15019
Notes: Made_by: Horvitz Lab|"mir-357 and mir358 are deleted in this strain. Deletion breakpoints are:TTCTGTTTGACGATGATG / GGGACGATTCAACGGTCA...CATTTAATGTATTTCACAT / CTTTTTGGGTTACTGTAGTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"mir-357 and mir358 are deleted in this strain. Deletion breakpoints are:TTCTGTTTGACGATGATG / GGGACGATTCAACGGTCA...CATTTAATGTATTTCACAT / CTTTTTGGGTTACTGTAGTT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027503 Copy
http://www.wormbase.org/db/get?name=WBStrain00027504
Source Database: WormBase (WB)
Affected Genes: WBGene00003340(mir-246)
Genomic Alteration: WBGene00003340(mir-246)
Availability: available
Source References: PMID:31307392
Synonyms: mir-246(n4636) IV.
Alternate IDs: WB-STRAIN:MT15020, CGC_MT15020
Notes: Deletion breakpoints are:GATACATCGGTGCAATGAAGA / CATCATCAGATAATATTCTCAA...ATGTTTCGGGTAGGAGCTGT / TCAAACTTTGGACATTGGCATC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GATACATCGGTGCAATGAAGA / CATCATCAGATAATATTCTCAA...ATGTTTCGGGTAGGAGCTGT / TCAAACTTTGGACATTGGCATC.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00027504 Copy
http://www.wormbase.org/db/get?name=WBStrain00027505
Source Database: WormBase (WB)
Affected Genes: WBGene00003306(mir-78)
Genomic Alteration: WBGene00003306(mir-78)
Availability: available
Source References: EMPTY
Synonyms: mir-78(n4637) IV.
Alternate IDs: WB-STRAIN:MT15021, CGC_MT15021
Notes: Deletion breakpoints are:CTTTCATACATCTATTTT / ATACGGAAATGTAAAAT...CTTGTTTCAAGCTATCC / ATTTTGCAACAATACTGT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:CTTTCATACATCTATTTT / ATACGGAAATGTAAAAT...CTTGTTTCAAGCTATCC / ATTTTGCAACAATACTGT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027505 Copy
http://www.wormbase.org/db/get?name=WBStrain00027586
Source Database: WormBase (WB)
Affected Genes: WBGene00002993(lin-4)|WBGene00003330(mir-237)
Genomic Alteration: WBGene00002993(lin-4), WBGene00003330(mir-237)
Availability: available
Source References: EMPTY
Synonyms: lin-4(e912) II; mir-237(n4296) X.
Alternate IDs: WB-STRAIN:MT18023, CGC_MT18023
Notes: Made_by: Ezequiel Alvarez-Saa|"Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73."
Proper citation: RRID:WB-STRAIN:WBStrain00027586 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
