Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MT18043 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027588 | Caenorhabditis elegans | mir-240&mir-786(n4541) X. | Deletion breakpoints are: TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members" | WBGene00003334(mir-240)|WBGene00045343(mir-786) | WBGene00003334(mir-240), WBGene00045343(mir-786) | WB-STRAIN:WBStrain00027588 | WormBase (WB) | WB | available | WB-STRAIN:MT18043, CGC_MT18043 | 2026-08-08 10:13:15 | 1 | |||
|
MY10 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027656 | Caenorhabditis elegans | EMPTY | Natural isolate; obtained in July 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU3.|"WBStrain provided so WBPaper00061063 paper added based on AFP_Strain data."|"Wild-type natural isolate" | WB-STRAIN:WBStrain00027656 | WormBase (WB) | WB | available | PMID:22301316 PMID:30078564 PMID:33593818 PMID:33820969 PMID:38547054 PMID:38564369 |
WB-STRAIN:MY10, CGC_MY10 | 2026-08-08 10:13:15 | 0 | ||||
|
MY4 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027650 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Natural isolate; obtained in July 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU3. | WB-STRAIN:WBStrain00027650 | WormBase (WB) | WB | available | WB-STRAIN:MY4, CGC_MY4 | 2026-08-08 10:13:15 | 0 | |||||
|
MY3 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027649 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Natural isolate; obtained in July 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU3.|"WBStrain mapped, WBPaper00061409 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061527 added based on AFP_Strain data." | WB-STRAIN:WBStrain00027649 | WormBase (WB) | WB | available | WB-STRAIN:MY3, CGC_MY3 | 2026-08-08 10:13:15 | 0 | |||||
|
MX124 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027645 | Caenorhabditis elegans | ifta-1(nx61) X. | Homozygous viable with no obvious morphological, locomotory, or behavioral phenotypes. However, these animals display cilia-related chemosensory (Che) defective and dye-fill (Dyf) defective phenotypes. 2009 bp deletion with flanking sequences of GATAAGAGGAAATCTTTTTGGAGAGTTGGA and ATTTAGTTTTTCACAAAGAACACCGCAATA. | WBGene00016935(ifta-1) | WBGene00016935(ifta-1) | WB-STRAIN:WBStrain00027645 | WormBase (WB) | WB | available | PMID:38302462 | WB-STRAIN:MX124, CGC_MX124 | 2026-08-08 10:13:15 | 1 | ||
|
MY1 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027647 | Caenorhabditis elegans | wild | Natural isolate; obtained in April 2002 from compost heap in Lingen, Emsland, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU1. | WB-STRAIN:WBStrain00027647 | WormBase (WB) | WB | available | PMID:22301316 PMID:31422888 PMID:33820969 PMID:34622777 PMID:38564369 PMID:38865452 |
WB-STRAIN:MY1, CGC_MY1 | 2026-08-08 10:13:15 | 2 | ||||
|
MX52 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027641 | Caenorhabditis elegans | bbs-8(nx77) V | Displays Dyf, Che and Odr phenotypes. nx77 is a double deletion in bbs-8. Nucleotides 612-759 and 826-1631 of bbs-8 (numbers refer to unspliced gene sequence) are removed.|"Mutagen:UV/TMP"|"WBStrain mapped, WBPaper00060242 added based on AFP_Strain data." | WBGene00000244(bbs-8) | WBGene00000244(bbs-8) | WB-STRAIN:WBStrain00027641 | WormBase (WB) | WB | available | PMID:32101165 PMID:32916106 PMID:34533135 PMID:38302462 PMID:38421867 |
WB-STRAIN:MX52, CGC_MX52 | 2026-08-08 10:13:15 | 0 | ||
|
MY22 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027668 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Natural isolate; obtained in October 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU5. | WB-STRAIN:WBStrain00027668 | WormBase (WB) | WB | available | WB-STRAIN:MY22, CGC_MY22 | 2026-08-08 10:13:15 | 0 | |||||
|
MY17 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027663 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Natural isolate. Obtained in October 2002 from a compost heap in Roxel, Munster, Northwest Germany. Frozen within 5 generations after isolation. Microsatellite genotype EU5. | WB-STRAIN:WBStrain00027663 | WormBase (WB) | WB | available | WB-STRAIN:MY17, CGC_MY17 | 2026-08-08 10:13:16 | 0 | |||||
|
MY18 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027664 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Natural isolate. Obtained in October 2002 from a compost heap in Roxel, Munster, Northwest Germany. Frozen within 5 generations after isolation. Microsatellite genotype EU4. | WB-STRAIN:WBStrain00027664 | WormBase (WB) | WB | available | PMID:22301316 PMID:33820969 PMID:38564369 PMID:38865452 PMID:39303031 |
WB-STRAIN:MY18, CGC_MY18 | 2026-08-08 10:13:16 | 1 | ||||
|
MY19 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027665 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Natural isolate. Obtained in October 2002 from a compost heap in Roxel, Munster, Northwest Germany. Frozen within 5 generations after isolation. Microsatellite genotype EU3. | WB-STRAIN:WBStrain00027665 | WormBase (WB) | WB | available | PMID:22301316 | WB-STRAIN:MY19, CGC_MY19 | 2026-08-08 10:13:15 | 0 | ||||
|
MY20 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027666 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Natural isolate; obtained in October 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU3. | WB-STRAIN:WBStrain00027666 | WormBase (WB) | WB | available | WB-STRAIN:MY20, CGC_MY20 | 2026-08-08 10:13:16 | 0 | |||||
|
MT20492 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027617 | Caenorhabditis elegans | lin-15B&lin-15A(n765) X; nIs471. | Mutagen:Gamma radiation|"nIs471 [lgc-55::GFP + lin-15(+)]. GFP expression in GLR glia-like cells and head muscles. Reference: Ringstad N, et al. Science. 2009 Jul 3;325(5936):96-100."|"nIs471 [lgc-55::GFP + lin-15(+)]. GFP exrpession in GLR glia-like cells and head muscles. Reference: Ringstad N, et al. Science. 2009 Jul 3;325(5936):96-100." | WBGene00023497(lin-15B)|WBGene00023498(lin-15A) | WBGene00023497(lin-15B), WBGene00023498(lin-15A) | WB-STRAIN:WBStrain00027617 | WormBase (WB) | WB | available | WB-STRAIN:MT20492, CGC_MT20492 | 2026-08-08 10:13:15 | 0 | |||
|
MT21478 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027619 | Caenorhabditis elegans | set-17(n5017) II ; unc-119(ed3) III ; nSi3 IV | Mutagen:MOS Transposase|"nSi3 [set-17p::set-17(+)::GFP::set-17 3UTR + unc-119(+)] IV. nSi3 expresses a translational fusion of genomic set-17 and GFP. nSi3 rescues the brood size defect of n5017 in this strain. nSi3 is a single copy MOS-mediated transposition into the cxTi10882 site; GFP detectable in the nuclei of the hypoderm, sperm and proximal germline, as well as some other cells. Reference: Engert CG, et al. PLoS Genet. 2018 Apr 27;14(4):e1007295." | WBGene00006843(unc-119)|WBGene00011887(set-17) | WBGene00006843(unc-119), WBGene00011887(set-17) | WB-STRAIN:WBStrain00027619 | WormBase (WB) | WB | available | WB-STRAIN:MT21478, CGC_MT21478 | 2026-08-08 10:13:15 | 0 | |||
|
MT20113 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027612 | Caenorhabditis elegans | unc-32(e189) dpy-18(e499)/eT1 III; +/eT1 nIs267 V. | nIs267 [myo-2::GFP] integrated in or near eT1. Heterozygotes are wild-type and segregate WT, Dpy Unc, and Unc. Maintain by picking wild-type; check for presence of Unc progeny. | WBGene00001077(dpy-18)|WBGene00006768(unc-32) | WBGene00001077(dpy-18), WBGene00006768(unc-32) | WB-STRAIN:WBStrain00027612 | WormBase (WB) | WB | available | WB-STRAIN:MT20113, CGC_MT20113 | 2026-08-08 10:13:15 | 0 | |||
|
MT20298 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027615 | Caenorhabditis elegans | nIs408 I; nIs454 II. | Made_by: Dave Harris|"nIs408 [lin-29p::lin-29::mCherry + ttx-3p::GFP] I. nIs454 [mab-10p::mab-10::GFP + ttx-3p::GFP] II. Reference: Harris DT, Horvitz HR. Development. 2011 Sep;138(18):4051-62." | WB-STRAIN:WBStrain00027615 | WormBase (WB) | WB | available | WB-STRAIN:MT20298, CGC_MT20298 | 2026-08-08 10:13:15 | 0 | |||||
|
MT20110 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027609 | Caenorhabditis elegans | unc-4(e120) rol-1(e91)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II. | nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Heterozygotes are WT. Segregates WT and Egl Unc Rol; no Dpy Uncs are seen as nIs190 mnC1 homozygotes are embryonic lethal.|"nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Heterozygotes are WT. Segregates WT GFP+ and Egl Unc Rol; no Dpy Uncs are seen as nIs190 mnC1 homozygotes are embryonic lethal." | WBGene00001072(dpy-10)|WBGene00004394(rol-1)|WBGene00006744(unc-4)|WBGene00006787(unc-52) | WBGene00001072(dpy-10), WBGene00004394(rol-1), WBGene00006744(unc-4), WBGene00006787(unc-52) | WB-STRAIN:WBStrain00027609 | WormBase (WB) | WB | available | WB-STRAIN:MT20110, CGC_MT20110 | 2026-08-08 10:13:15 | 0 | |||
|
MT19859 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027605 | Caenorhabditis elegans | nIs431 X. | Mutagen:Gamma ray|"nIs431 [GFP::sptf-3] X. GFP::SPTF-3 is ubiquitously expressed. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8." | WB-STRAIN:WBStrain00027605 | WormBase (WB) | WB | available | WB-STRAIN:MT19859, CGC_MT19859 | 2026-08-08 10:13:14 | 0 | |||||
|
MU1255 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027634 | Caenorhabditis elegans | nhr-67(tm2217) IV/nT1 [qIs51] (IV;V). | Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP tm2217 homozygotes (arrested L1 larvae). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.|"Mutagen:UV/TMP" | WBGene00003657(nhr-67) | WBGene00003657(nhr-67) | WB-STRAIN:WBStrain00027634 | WormBase (WB) | WB | available | WB-STRAIN:MU1255, CGC_MU1255 | 2026-08-08 10:13:15 | 0 | |||
|
MU1268 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027635 | Caenorhabditis elegans | bwIs6. | bwIs6 [nhr-67::GFP + rol-6(su1006)]. Rollers.|"Mutagen:Gamma radiation" | WB-STRAIN:WBStrain00027635 | WormBase (WB) | WB | available | WB-STRAIN:MU1268, CGC_MU1268 | 2026-08-08 10:13:15 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
