Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00027588
Source Database: WormBase (WB)
Affected Genes: WBGene00003334(mir-240)|WBGene00045343(mir-786)
Genomic Alteration: WBGene00003334(mir-240), WBGene00045343(mir-786)
Availability: available
Source References: EMPTY
Synonyms: mir-240&mir-786(n4541) X.
Alternate IDs: WB-STRAIN:MT18043, CGC_MT18043
Notes: Deletion breakpoints are: TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"
Proper citation: RRID:WB-STRAIN:WBStrain00027588 Copy
http://www.wormbase.org/db/get?name=WBStrain00027656
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:30078564, PMID:33593818, PMID:33820969, PMID:38547054, PMID:38564369
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:MY10, CGC_MY10
Notes: Natural isolate; obtained in July 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU3.|"WBStrain provided so WBPaper00061063 paper added based on AFP_Strain data."|"Wild-type natural isolate"
Proper citation: RRID:WB-STRAIN:WBStrain00027656 Copy
http://www.wormbase.org/db/get?name=WBStrain00027650
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:MY4, CGC_MY4
Notes: Natural isolate; obtained in July 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU3.
Proper citation: RRID:WB-STRAIN:WBStrain00027650 Copy
http://www.wormbase.org/db/get?name=WBStrain00027649
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:MY3, CGC_MY3
Notes: Natural isolate; obtained in July 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU3.|"WBStrain mapped, WBPaper00061409 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061527 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00027649 Copy
http://www.wormbase.org/db/get?name=WBStrain00027645
Source Database: WormBase (WB)
Affected Genes: WBGene00016935(ifta-1)
Genomic Alteration: WBGene00016935(ifta-1)
Availability: available
Source References: PMID:38302462
Synonyms: ifta-1(nx61) X.
Alternate IDs: WB-STRAIN:MX124, CGC_MX124
Notes: Homozygous viable with no obvious morphological, locomotory, or behavioral phenotypes. However, these animals display cilia-related chemosensory (Che) defective and dye-fill (Dyf) defective phenotypes. 2009 bp deletion with flanking sequences of GATAAGAGGAAATCTTTTTGGAGAGTTGGA and ATTTAGTTTTTCACAAAGAACACCGCAATA.
Proper citation: RRID:WB-STRAIN:WBStrain00027645 Copy
http://www.wormbase.org/db/get?name=WBStrain00027647
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:31422888, PMID:33820969, PMID:34622777, PMID:38564369, PMID:38865452
Synonyms: wild
Alternate IDs: WB-STRAIN:MY1, CGC_MY1
Notes: Natural isolate; obtained in April 2002 from compost heap in Lingen, Emsland, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU1.
Proper citation: RRID:WB-STRAIN:WBStrain00027647 Copy
http://www.wormbase.org/db/get?name=WBStrain00027641
Source Database: WormBase (WB)
Affected Genes: WBGene00000244(bbs-8)
Genomic Alteration: WBGene00000244(bbs-8)
Availability: available
Source References: PMID:32101165, PMID:32916106, PMID:34533135, PMID:38302462, PMID:38421867
Synonyms: bbs-8(nx77) V
Alternate IDs: WB-STRAIN:MX52, CGC_MX52
Notes: Displays Dyf, Che and Odr phenotypes. nx77 is a double deletion in bbs-8. Nucleotides 612-759 and 826-1631 of bbs-8 (numbers refer to unspliced gene sequence) are removed.|"Mutagen:UV/TMP"|"WBStrain mapped, WBPaper00060242 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00027641 Copy
http://www.wormbase.org/db/get?name=WBStrain00027668
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:MY22, CGC_MY22
Notes: Natural isolate; obtained in October 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU5.
Proper citation: RRID:WB-STRAIN:WBStrain00027668 Copy
http://www.wormbase.org/db/get?name=WBStrain00027663
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:MY17, CGC_MY17
Notes: Natural isolate. Obtained in October 2002 from a compost heap in Roxel, Munster, Northwest Germany. Frozen within 5 generations after isolation. Microsatellite genotype EU5.
Proper citation: RRID:WB-STRAIN:WBStrain00027663 Copy
http://www.wormbase.org/db/get?name=WBStrain00027664
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:38564369, PMID:38865452, PMID:39303031
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:MY18, CGC_MY18
Notes: Natural isolate. Obtained in October 2002 from a compost heap in Roxel, Munster, Northwest Germany. Frozen within 5 generations after isolation. Microsatellite genotype EU4.
Proper citation: RRID:WB-STRAIN:WBStrain00027664 Copy
http://www.wormbase.org/db/get?name=WBStrain00027665
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:MY19, CGC_MY19
Notes: Natural isolate. Obtained in October 2002 from a compost heap in Roxel, Munster, Northwest Germany. Frozen within 5 generations after isolation. Microsatellite genotype EU3.
Proper citation: RRID:WB-STRAIN:WBStrain00027665 Copy
http://www.wormbase.org/db/get?name=WBStrain00027666
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:MY20, CGC_MY20
Notes: Natural isolate; obtained in October 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU3.
Proper citation: RRID:WB-STRAIN:WBStrain00027666 Copy
http://www.wormbase.org/db/get?name=WBStrain00027617
Source Database: WormBase (WB)
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Source References: EMPTY
Synonyms: lin-15B&lin-15A(n765) X; nIs471.
Alternate IDs: WB-STRAIN:MT20492, CGC_MT20492
Notes: Mutagen:Gamma radiation|"nIs471 [lgc-55::GFP + lin-15(+)]. GFP expression in GLR glia-like cells and head muscles. Reference: Ringstad N, et al. Science. 2009 Jul 3;325(5936):96-100."|"nIs471 [lgc-55::GFP + lin-15(+)]. GFP exrpession in GLR glia-like cells and head muscles. Reference: Ringstad N, et al. Science. 2009 Jul 3;325(5936):96-100."
Proper citation: RRID:WB-STRAIN:WBStrain00027617 Copy
http://www.wormbase.org/db/get?name=WBStrain00027619
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)|WBGene00011887(set-17)
Genomic Alteration: WBGene00006843(unc-119), WBGene00011887(set-17)
Availability: available
Source References: EMPTY
Synonyms: set-17(n5017) II ; unc-119(ed3) III ; nSi3 IV
Alternate IDs: WB-STRAIN:MT21478, CGC_MT21478
Notes: Mutagen:MOS Transposase|"nSi3 [set-17p::set-17(+)::GFP::set-17 3UTR + unc-119(+)] IV. nSi3 expresses a translational fusion of genomic set-17 and GFP. nSi3 rescues the brood size defect of n5017 in this strain. nSi3 is a single copy MOS-mediated transposition into the cxTi10882 site; GFP detectable in the nuclei of the hypoderm, sperm and proximal germline, as well as some other cells. Reference: Engert CG, et al. PLoS Genet. 2018 Apr 27;14(4):e1007295."
Proper citation: RRID:WB-STRAIN:WBStrain00027619 Copy
http://www.wormbase.org/db/get?name=WBStrain00027612
Source Database: WormBase (WB)
Affected Genes: WBGene00001077(dpy-18)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00001077(dpy-18), WBGene00006768(unc-32)
Availability: available
Source References: EMPTY
Synonyms: unc-32(e189) dpy-18(e499)/eT1 III; +/eT1 nIs267 V.
Alternate IDs: WB-STRAIN:MT20113, CGC_MT20113
Notes: nIs267 [myo-2::GFP] integrated in or near eT1. Heterozygotes are wild-type and segregate WT, Dpy Unc, and Unc. Maintain by picking wild-type; check for presence of Unc progeny.
Proper citation: RRID:WB-STRAIN:WBStrain00027612 Copy
http://www.wormbase.org/db/get?name=WBStrain00027615
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: nIs408 I; nIs454 II.
Alternate IDs: WB-STRAIN:MT20298, CGC_MT20298
Notes: Made_by: Dave Harris|"nIs408 [lin-29p::lin-29::mCherry + ttx-3p::GFP] I. nIs454 [mab-10p::mab-10::GFP + ttx-3p::GFP] II. Reference: Harris DT, Horvitz HR. Development. 2011 Sep;138(18):4051-62."
Proper citation: RRID:WB-STRAIN:WBStrain00027615 Copy
http://www.wormbase.org/db/get?name=WBStrain00027609
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00004394(rol-1)|WBGene00006744(unc-4)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00004394(rol-1), WBGene00006744(unc-4), WBGene00006787(unc-52)
Availability: available
Source References: EMPTY
Synonyms: unc-4(e120) rol-1(e91)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II.
Alternate IDs: WB-STRAIN:MT20110, CGC_MT20110
Notes: nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Heterozygotes are WT. Segregates WT and Egl Unc Rol; no Dpy Uncs are seen as nIs190 mnC1 homozygotes are embryonic lethal.|"nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Heterozygotes are WT. Segregates WT GFP+ and Egl Unc Rol; no Dpy Uncs are seen as nIs190 mnC1 homozygotes are embryonic lethal."
Proper citation: RRID:WB-STRAIN:WBStrain00027609 Copy
http://www.wormbase.org/db/get?name=WBStrain00027605
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: nIs431 X.
Alternate IDs: WB-STRAIN:MT19859, CGC_MT19859
Notes: Mutagen:Gamma ray|"nIs431 [GFP::sptf-3] X. GFP::SPTF-3 is ubiquitously expressed. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8."
Proper citation: RRID:WB-STRAIN:WBStrain00027605 Copy
http://www.wormbase.org/db/get?name=WBStrain00027634
Source Database: WormBase (WB)
Affected Genes: WBGene00003657(nhr-67)
Genomic Alteration: WBGene00003657(nhr-67)
Availability: available
Source References: EMPTY
Synonyms: nhr-67(tm2217) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:MU1255, CGC_MU1255
Notes: Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP tm2217 homozygotes (arrested L1 larvae). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027634 Copy
http://www.wormbase.org/db/get?name=WBStrain00027635
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: bwIs6.
Alternate IDs: WB-STRAIN:MU1268, CGC_MU1268
Notes: bwIs6 [nhr-67::GFP + rol-6(su1006)]. Rollers.|"Mutagen:Gamma radiation"
Proper citation: RRID:WB-STRAIN:WBStrain00027635 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.