Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00006375
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)
Genomic Alteration: WBGene00000898(daf-2)
Availability: unknown
Source References: PMID:21839827
Synonyms: daf-2(e1370) IIIC
Alternate IDs: WB-STRAIN:DR1563
Notes: Derived from CB1370 by backcrossing 3x with N2
Proper citation: RRID:WB-STRAIN:WBStrain00006375 Copy
http://www.wormbase.org/db/get?name=WBStrain00006371
Source Database: WormBase (WB)
Affected Genes: WBGene00004858(sma-4)
Genomic Alteration: WBGene00004858(sma-4)
Availability: available
Source References: PMID:4366476
Synonyms: sma-4(e729) III.
Alternate IDs: WB-STRAIN:DR1369, CGC_DR1369
Notes: Short, non-Dpy. Males have crumpled spicules.
Proper citation: RRID:WB-STRAIN:WBStrain00006371 Copy
http://www.wormbase.org/db/get?name=WBStrain00006382
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)
Genomic Alteration: WBGene00000898(daf-2)
Availability: available
Source References: PMID:9725835, PMID:37782016
Synonyms: daf-2(e1391) III.
Alternate IDs: WB-STRAIN:DR1574, CGC_DR1574
Notes: Class 2 allele of daf-2. Temperature sensitive Daf-c. Adults are long-lived (Age) and exhibit extrinsic thermotolerance (Itt). Produces some dauers at 15C. CGC received new stock 10/25/00 from David Gems. Received new stock from Patrice Albert in the Riddle lab 6/04.|"Substitution:Missense P->L"|"Supplementary_genotype daf-2(e1391)"
Proper citation: RRID:WB-STRAIN:WBStrain00006382 Copy
http://www.wormbase.org/db/get?name=WBStrain00006381
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)
Genomic Alteration: WBGene00000898(daf-2)
Availability: available
Source References: PMID:9725835, PMID:34505574, PMID:37991448, PMID:39164296
Synonyms: daf-2(e1368) III.
Alternate IDs: WB-STRAIN:DR1572, CGC_DR1572
Notes: Maintain at 15C. Class 1 allele of daf-2. Temperature sensitive Daf-c. Adults are long-lived (Age) and exhibit extrinsic thermotolerance (Itt).
Proper citation: RRID:WB-STRAIN:WBStrain00006381 Copy
http://www.wormbase.org/db/get?name=WBStrain00006380
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)
Genomic Alteration: WBGene00000898(daf-2)
Availability: available
Source References: PMID:9725835
Synonyms: daf-2(e1371) III.
Alternate IDs: WB-STRAIN:DR1568, CGC_DR1568
Notes: Class 1 allele of daf-2. Temperature sensitive Daf-c. Maintain at 15C. Adults are long-lived (Age) and exhibit extrinsic thermotolerance (Itt).
Proper citation: RRID:WB-STRAIN:WBStrain00006380 Copy
http://www.wormbase.org/db/get?name=WBStrain00006378
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)
Genomic Alteration: WBGene00000898(daf-2)
Availability: available
Synonyms: daf-2(m579) III.
Alternate IDs: WB-STRAIN:DR1566, CGC_DR1566
Notes: Adults Age and Itt and temperature sensitive Unc (class 2 allele). m579 results in an amino acid substitution(R437C) in the extracellular portion of the DAF-2 receptor (specifically, the Cys-rich domain).|"Made_by: Riddle Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00006378 Copy
http://www.wormbase.org/db/get?name=WBStrain00006439
Source Database: WormBase (WB)
Affected Genes: WBGene00000264(brc-1)
Genomic Alteration: WBGene00000264(brc-1)
Availability: available
Source References: PMID:33262405, PMID:38894809, PMID:39115289
Synonyms: brc-1(tm1145) III.
Alternate IDs: WB-STRAIN:DW102, CGC_DW102
Notes: Homozygous viable. Weak Him phenotype (2-3%). Extremely sensitive to ionizing radiation and other DNA damaging agents.|"Mutagen:UVA+TMP"|"Mutagen:UVA/TMP"|"Reference WBPaper00060693 added based on published strain data identified by Textpresso literature search."
Proper citation: RRID:WB-STRAIN:WBStrain00006439 Copy
http://www.wormbase.org/db/get?name=WBStrain00006438
Source Database: WormBase (WB)
Affected Genes: WBGene00000226(atl-1)
Genomic Alteration: WBGene00000226(atl-1)
Availability: available
Synonyms: atl-1(tm853) V/nT1 [unc-?(n754) let-? qIs50] (IV;V).
Alternate IDs: WB-STRAIN:DW101, CGC_DW101
Notes: Heterozygotes are Unc and GFP+ with signal in the pharynx. atl-1(tm853) homozygotes are non-Unc, viable, GFP-, and produce 100% dead embryos. qIs50 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter (F22B7.9) driving GFP in the intestine. nT1[unc-?(n754) let-? qIs50] is also known as DnT1[qIs50]. qIs50 is apparently inserted on DnT1. qIs50 is somewhat dimmer than the similar qIs51.|"Made_by: Mitani/Garcia-Muse"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00006438 Copy
http://www.wormbase.org/db/get?name=WBStrain00006452
Source Database: WormBase (WB)
Affected Genes: WBGene00006604(tra-1)
Genomic Alteration: WBGene00006604(tra-1)
Availability: available
Source References: PMID:32857970
Synonyms: tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III.
Alternate IDs: WB-STRAIN:DZ840, CGC_DZ840
Notes: tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III.|"WBStrain mapped, WBPaper00060142 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00006452 Copy
http://www.wormbase.org/db/get?name=WBStrain00006446
Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)
Genomic Alteration: WBGene00001867(him-8)
Availability: available
Synonyms: ezIs2 III; him-8(e1489) IV.
Alternate IDs: WB-STRAIN:DZ325, CGC_DZ325
Notes: ezIs2 [fkh-6::GFP + unc-119(+)]. ezIs2 was integrated with pPD95.69 (fkh-6 promoter and unc-54 3') and pMM106b (unc-119(+)). Worms are 100% non-Unc (the unc-119 background has been crossed out). GFP expression in adult hermaphrodite spermatheca is bright and weak staining is also observed in the proximal sheath cells. Weak GFP staining is also observed in Z1/Z4 cells in both sexes.|"Made_by: Weiru Chang"|"Mutagen:Gamma Rays"
Proper citation: RRID:WB-STRAIN:WBStrain00006446 Copy
http://www.wormbase.org/db/get?name=WBStrain00006412
Source Database: WormBase (WB)
Affected Genes: WBGene00003133(apc-1)
Genomic Alteration: WBGene00003133(apc-1)
Availability: available
Synonyms: apc-1(ax102) II.
Alternate IDs: WB-STRAIN:DS98, CGC_DS98
Notes: Made_by: Matt Wallenfang|"Temperature sensitive. Maintain at 15C. Formerly known as mat-2."
Proper citation: RRID:WB-STRAIN:WBStrain00006412 Copy
http://www.wormbase.org/db/get?name=WBStrain00006678
Source Database: WormBase (WB)
Affected Genes: WBGene00006763(unc-26)
Genomic Alteration: WBGene00006763(unc-26)
Availability: available
Source References: PMID:35065714, PMID:37053235
Synonyms: unc-26(s1710) IV.
Alternate IDs: WB-STRAIN:EG3027, CGC_EG3027
Notes: Severe kinker. Small and scrawny with flaccid little movement. Slow pharyngeal pumping.
Proper citation: RRID:WB-STRAIN:WBStrain00006678 Copy
http://www.wormbase.org/db/get?name=WBStrain00006618
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3011, CGC_ED3011
Notes: Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Nov. 26, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): J.|"Made_by: A. Cutter/E. Dolgin"
Proper citation: RRID:WB-STRAIN:WBStrain00006618 Copy
http://www.wormbase.org/db/get?name=WBStrain00006698
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33593818, PMID:33820969, PMID:38564369, PMID:39303031, PMID:39853894
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:EG4725, CGC_EG4725
Notes: Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.|"WBStrain provided so WBPaper00061063 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00006698 Copy
http://www.wormbase.org/db/get?name=WBStrain00006622
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3017, CGC_ED3017
Notes: Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): N.|"Made_by: A. Cutter/E. Dolgin"
Proper citation: RRID:WB-STRAIN:WBStrain00006622 Copy
http://www.wormbase.org/db/get?name=WBStrain00006640
Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:37008729, PMID:37572357, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3052, CGC_ED3052
Notes: Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): delta.|"Made_by: E. Dolgin"|"Supplementary_genotype"
Proper citation: RRID:WB-STRAIN:WBStrain00006640 Copy
http://www.wormbase.org/db/get?name=WBStrain00006635
Source Database: WormBase (WB)
Availability: available
Source References: PMID:32857789, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3046, CGC_ED3046
Notes: Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): gamma.|"Made_by: E. Dolgin"
Proper citation: RRID:WB-STRAIN:WBStrain00006635 Copy
http://www.wormbase.org/db/get?name=WBStrain00006661
Source Database: WormBase (WB)
Affected Genes: WBGene00001373(exp-1)
Genomic Alteration: WBGene00001373(exp-1)
Availability: available
Synonyms: exp-1(ox276) II.
Alternate IDs: WB-STRAIN:EG276, CGC_EG276
Notes: Maintain under normal conditions. Reference: Beg AA & Jorgensen EM, Nat Neurosci. 2003 Nov;6(11):1145-52.
Proper citation: RRID:WB-STRAIN:WBStrain00006661 Copy
http://www.wormbase.org/db/get?name=WBStrain00006660
Source Database: WormBase (WB)
Affected Genes: WBGene00003553(nas-37)
Genomic Alteration: WBGene00003553(nas-37)
Availability: available
Source References: PMID:38177158
Synonyms: nas-37(ox199) X.
Alternate IDs: WB-STRAIN:EG199, CGC_EG199
Notes: At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA.
Proper citation: RRID:WB-STRAIN:WBStrain00006660 Copy
http://www.wormbase.org/db/get?name=WBStrain00006659
Source Database: WormBase (WB)
Affected Genes: WBGene00002138(inx-16)
Genomic Alteration: WBGene00002138(inx-16)
Availability: available
Synonyms: inx-16(ox144) I.
Alternate IDs: WB-STRAIN:EG144, CGC_EG144
Notes: Pax, Dec-slow (34 defecation cycle). Maintain uder normal conditions. Reference: Peters MA, et al. Curr Biol. 2007 Sep 18;17(18):1601-8.
Proper citation: RRID:WB-STRAIN:WBStrain00006659 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
