Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 6 showing 101 ~ 120 out of 224 results
Snippet view Table view Download 224 Result(s)
Click the to add this resource to a Collection
  • RRID:RGD_11553914

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553914

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 11553914
Notes: ZFN system was used to introduce a mutation in the Shc1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in Exon 2 of theShc1 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_11553914 Copy   


  • RRID:RGD_11553904

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553904

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 11553904
Notes: ZFN system was used to introduce a mutation in the Shc1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 27-bp deletion in Exon 1 of the Shc1 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_11553904 Copy   


  • RRID:RGD_10059573

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10059573

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 10059573
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Adora2a gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion and 5-bp insertion in the Adora2a gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10059573 Copy   


  • RRID:RGD_11553860

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553860

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 11553860
Notes: ZFN system was used to introduce a mutation in the Scn5a gene of DA/MolTac rat embryos. The resulting mutation is a 110-bp deletion in Exon 4 of the Scn5a gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_11553860 Copy   


  • RRID:RGD_11553886

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553886

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 11553886
Notes: ZFN system was used to introduce a mutation in the Trp53 gene of Crl:SD rat embryos.The resulting mutation is a 84-bp deletion in Exon 3 of the Tp53 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_11553886 Copy   


  • RRID:RGD_11553881

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553881

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 11553881
Notes: ZFN system was used to introduce a mutation in the Rbm20 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in Exon 2 of the Rbm20 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_11553881 Copy   


  • RRID:RGD_4139874

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139874

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 4139874
Notes: This strain was produced by injecting ZFNs targeting the sequence aacccatgtccgggattgggtgatgtgggctgtgaatgag into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 3.

Proper citation: RRID:RGD_4139874 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139875

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 4139875
Notes: This strain was produced by injecting ZFNs targeting the sequence ataaacctttcccaggatacattgacccggattct into FHH-Chr 1BN/Mcwi embryos. The resulting mutation is a 14-bp frameshift deletion mutation in exon 20.

Proper citation: RRID:RGD_4139875 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139877

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 4139877
Notes: This strain was produced by injecting ZFNs targeting the sequence CACCAAAACTTCTCCTCCCACTACCGGGCCACCATTGGT into FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 1.

Proper citation: RRID:RGD_4139877 Copy   


  • RRID:RGD_5143988

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5143988

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 5143988
Notes: This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 2.

Proper citation: RRID:RGD_5143988 Copy   


  • RRID:RGD_5143986

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5143986

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 5143986
Notes: This strain was produced by injecting ZFNs targeting the sequence CGCTCTACATGGCTCCTGAgatggtGTGTCGGCGGCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5.

Proper citation: RRID:RGD_5143986 Copy   


  • RRID:RGD_5131991

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131991

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 5131991
Notes: This strain was produced by injecting ZFNs targeting the sequence TATCACTGCCACAACagcttcAAGGCCACAGGGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 2.

Proper citation: RRID:RGD_5131991 Copy   


  • RRID:RGD_5131911

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131911

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 5131911
Notes: This strain was produced by injecting ZFNs targeting the sequence CCCGCCTCCGACTCCGCCtccgtcCTCCCGGCACCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 1.

Proper citation: RRID:RGD_5131911 Copy   


  • RRID:RGD_5131912

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131912

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 5131912
Notes: This strain was produced by injecting ZFNs targeting the sequence AACGGCAAGCCTTATGtcatcTCCTACCTGGTGGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 4.

Proper citation: RRID:RGD_5131912 Copy   


  • RRID:RGD_5131989

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131989

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 5131989
Notes: This strain was produced by injecting ZFNs targeting the sequence CTGCTCCCACTCCCGTGGcttctAGTGCTGACGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 3.

Proper citation: RRID:RGD_5131989 Copy   


  • RRID:RGD_5131974

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131974

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 5131974
Notes: This strain was produced by injecting ZFNs targeting the sequence TTCCCCCACAACACCTAATaagcctGTGGTACCCCTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a net insertion of 5-bp frameshift deletion in exon 12.

Proper citation: RRID:RGD_5131974 Copy   


  • RRID:RGD_5131975

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131975

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 5131975
Notes: This strain was produced by injecting ZFNs targeting the sequence CTCTCCGTCCGCACTggtgaTGACAAAGGGGAGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 4.

Proper citation: RRID:RGD_5131975 Copy   


  • RRID:RGD_5131963

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131963

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 5131963
Notes: This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 7.

Proper citation: RRID:RGD_5131963 Copy   


  • RRID:RGD_5131964

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131964

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 5131964
Notes: This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 2.

Proper citation: RRID:RGD_5131964 Copy   


  • RRID:RGD_5131965

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131965

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 5131965
Notes: This strain was produced by injecting ZFNs targeting the sequence CCCCAGCCCCCGATCtgaggGCAGCAGCAGTGGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 28-bp frameshift deletion in exon 2.

Proper citation: RRID:RGD_5131965 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X