Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5686732
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 5686732
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5686732 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6893439
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 6893439
Notes: This strain was produced by injecting ZFNs targeting the sequence CACACCCAGGCCATCCCTGgacttCAGGAGCCGGCTAAGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 5.
Proper citation: RRID:RGD_6893439 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5686734
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryorecovery (as of 2018-09-05)
Alternate IDs: 5686734
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5686734 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688119
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-08-24)
Alternate IDs: 5688119
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained heterozygous breeders.
Proper citation: RRID:RGD_5688119 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688113
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 5688113
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5688113 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6893431
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 6893431
Notes: This strain was produced by injecting ZFNs targeting the sequence GACTTCATCAATCAGTACtataaCTCGATCAAAAGGTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 165-bp deletion including part of exon 3, intron 3, and part of exon 4
Proper citation: RRID:RGD_6893431 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688111
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-09-05)
Alternate IDs: 5688111
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5688111 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6893600
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-07-24)
Alternate IDs: 6893600
Notes: This strain was produced by injecting ZFNs targeting the sequence GAAAGCTGCCCACCTCATGgatgtgGCCGGAAACAAGGTGGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 98-bp frameshift deletion in exon 4.
Proper citation: RRID:RGD_6893600 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5686762
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryorecovery (as of 2018-09-05)
Alternate IDs: 5686762
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5686762 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5686760
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 5686760
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5686760 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6893440
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 6893440
Notes: This strain was produced by injecting ZFNs targeting the sequence TCCATCCCGAACTACAACaacttcCACGCAGCCGGGGGCCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 4.
Proper citation: RRID:RGD_6893440 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5686758
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2018-09-05)
Alternate IDs: 5686758
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5686758 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7241596
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm
Alternate IDs: 7241596
Notes: Heterozygous offsprings were intercrossed and maintained as wild type
Proper citation: RRID:RGD_7241596 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7241595
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm
Alternate IDs: 7241595
Notes: Heterozygous offspring were intercrossed and maintained as wild type
Proper citation: RRID:RGD_7241595 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7241594
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-25)
Alternate IDs: 7241594
Notes: This mutation, a deletion in chromosome 1 between bp 260,070,892 and 260,166,363, was originally found in the offspring of Hsd:SD x Hsd:SD. The phenotype was an altered titin isoform expression in the offspring. The parent carrier was identified by crossing both the male and the female Hsd:SD with F344/NHsd. This mutation is maintained on Hsd:SD X F344/NHsd.
Proper citation: RRID:RGD_7241594 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7241597
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-25)
Alternate IDs: 7241597
Notes: This mutation, a deletion in chromosome 1 between bp 260,070,892 and 260,166,363, was originally found in the offspring of Hsd:SD x Hsd:SD. The phenotype was an altered titin isoform expression in the offspring. The parent carrier was identified by crossing both the male and the female Hsd:SD with F344/NHsd. This mutation is maintained on Hsd:SD X F344/NHsd.
Proper citation: RRID:RGD_7241597 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=8552371
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 8552371
Notes: This strain was produced by knock-in in the rat ROSA26 locus using the construct 5' arm--tdTomato--IRES-Puro^r-pA--3' arm (11 kb) to the WDB/Nips strain. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN
Proper citation: RRID:RGD_8552371 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7241049
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2024-11-26)
Alternate IDs: 7241049
Notes: ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offspring which were intercrossed and offspring maintained as homozygous. This allele was made by ZFN mutagenesis. The resulting mutation is a 26-bp frameshift deletion in exon 4 (ACTACTACCCAGAAGGCCTGGGCCAC). inotiv
Proper citation: RRID:RGD_7241049 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7241048
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 7241048
Notes: This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 9-bp deletion with 1-bp insertion in exon 5 Sigma Advanced Genetic Engineering Labs
Proper citation: RRID:RGD_7241048 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=7241047
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2017-06-06)
Alternate IDs: 7241047
Notes: This strain was produced by crossing LE-Lrrk1em1Sage with LE-Lrrk2em1Sage Horizon Discovery
Proper citation: RRID:RGD_7241047 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.