Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00003810
Source Database: WormBase (WB)
Affected Genes: WBGene00004399(rol-9)
Genomic Alteration: WBGene00004399(rol-9)
Availability: available
Synonyms: rol-9(sc149) V.
Alternate IDs: WB-STRAIN:BE149, CGC_BE149
Notes: Strong right roller.
Proper citation: RRID:WB-STRAIN:WBStrain00003810 Copy
http://www.wormbase.org/db/get?name=WBStrain00003898
Source Database: WormBase (WB)
Affected Genes: WBGene00000100(ajm-1)|WBGene00000439(ceh-16)|WBGene00002980(lgg-1)
Genomic Alteration: WBGene00000100(ajm-1), WBGene00000439(ceh-16), WBGene00002980(lgg-1)
Availability: available
Synonyms: ceh-16(lg16) III; jcIs1 IV; ngEx1.
Alternate IDs: WB-STRAIN:BR2958, CGC_BR2958
Notes: jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. ngEx1[ceh-16::GFP]. ngEx1 rescues ceh-16(lg16) lethality. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and the gene encoding the antigen recognized by the monoclonal antibody MH27. jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Cassata et al. Development. 2005 Feb;132(4):739-49.|"Mutagen:UV/TMP"|"WBStrain mapped, WBPaper00061621 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00003898 Copy
http://www.wormbase.org/db/get?name=WBStrain00003897
Source Database: WormBase (WB)
Affected Genes: WBGene00000500(chn-1)
Genomic Alteration: WBGene00000500(chn-1)
Availability: available
Source References: PMID:39384041
Synonyms: chn-1(by155) I.
Alternate IDs: WB-STRAIN:BR2823, CGC_BR2823
Notes: 989bp deletion. Primers used: RB1537 (external left): CAAGCTTAATTTGCACACAATGCGTCAG; RB1540 (external right): AGAAGAGGCAAGAATGGAACTTGTGCG; RB1538 (internal left): AACAATTTCCGCTTATTTTCAGCGTTTG; RB1539 (internal right): CTGAACCATTGAAAGCTTTTCAGATC. Deletion breakpoints (T09B4 coordinates): 32756/33746 through 32757/33747.|"Made_by: Hoppe/Sperl"
Proper citation: RRID:WB-STRAIN:WBStrain00003897 Copy
http://www.wormbase.org/db/get?name=WBStrain00003894
Source Database: WormBase (WB)
Affected Genes: WBGene00003877(pept-1)
Genomic Alteration: WBGene00003877(pept-1)
Availability: available
Source References: PMID:33157031, PMID:38991033, PMID:39284915
Synonyms: pept-1(lg601) X.
Alternate IDs: WB-STRAIN:BR2742, CGC_BR2742
Notes: Made_by: Elegene|"Mutagen:UV/TMP"|"Slow postembryonic development. Reduced brood size. Previously known as pep-2. [NOTE: the genotype of this strain was previously incorrectly annotated as lg1601. The correct allele name is lg601.] Reference: Meissner B, et al. J Biol Chem. 2004 Aug 27;279(35):36739-45."|"WBStrain mapped, WBPaper00060602 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00003894 Copy
http://www.wormbase.org/db/get?name=WBStrain00003895
Source Database: WormBase (WB)
Affected Genes: WBGene00004789(sgk-1)
Genomic Alteration: WBGene00004789(sgk-1)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:BR2773
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00003895 Copy
http://www.wormbase.org/db/get?name=WBStrain00003829
Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)
Genomic Alteration: WBGene00001867(him-8)
Availability: available
Source References: PMID:34534446
Synonyms: inIs179 [ida-1p::GFP] II; him-8(e1489) IV
Alternate IDs: WB-STRAIN:BL5717, CGC_BL5717
Notes: inIs179 [ida-1p::GFP]. GFP is expressed in a subset of neurons and the neuroendocrine uv1 cells of the vulva. Identified neurons include ADE, ALA, ASI, ASK, AUA, ASG, AVH, AVJ, AVK, VC, HSN, PDE, PVP, PHA, PHB, PHC. Male sex-specific neurons include CA and some ray neurons. Plasmid pida-1::GFP 7.6 was injected into N2 and integrated to generate BL5715, then crossed into him-8(e1489) background.|"Made_by: T Zahn/P MacMorris"|"Mutagen:Gamma rays"
Proper citation: RRID:WB-STRAIN:WBStrain00003829 Copy
http://www.wormbase.org/db/get?name=WBStrain00003828
Source Database: WormBase (WB)
Affected Genes: WBGene00004385(rnp-2)|WBGene00004386(rnp-3)
Genomic Alteration: WBGene00004385(rnp-2), WBGene00004386(rnp-3)
Availability: unknown
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:BL1240
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00003828 Copy
http://www.wormbase.org/db/get?name=WBStrain00003821
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:27881675
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:BK16
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00003821 Copy
http://www.wormbase.org/db/get?name=WBStrain00003822
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:27881675
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:BK18
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00003822 Copy
http://www.wormbase.org/db/get?name=WBStrain00003820
Source Database: WormBase (WB)
Affected Genes: WBGene00000834(cua-1)
Genomic Alteration: WBGene00000834(cua-1)
Availability: unknown
Source References: PMID:27881675
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:BK15
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00003820 Copy
http://www.wormbase.org/db/get?name=WBStrain00003838
Source Database: WormBase (WB)
Affected Genes: WBGene00003805(npp-19)
Genomic Alteration: WBGene00003805(npp-19)
Availability: available
Source References: PMID:37995185
Synonyms: npp-19(tm2886) II; bqIs7.
Alternate IDs: WB-STRAIN:BN46, CGC_BN46
Notes: bqIs7 [pie-1p::LAP::npp-19 + unc-119(+)]; rescues Emb defects. Rodenas et al, Dev Biol. 2009 327:399-409.|"Supplementary_genotype GFP-NPP-19; bqIs7 [pie-1p:LAP:npp-19 + unc-119(+)]"
Proper citation: RRID:WB-STRAIN:WBStrain00003838 Copy
http://www.wormbase.org/db/get?name=WBStrain00003837
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003791(npp-5)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003791(npp-5)
Availability: available
Synonyms: npp-5(tm3039)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:BN40, CGC_BN40
Notes: Homozygous deletion chromosome balanced by GFP- and dpy-10-marked inversion. tm3039 homozygotes are viable but produce progengy that are primarily Lva or Lvl. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm3039 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Rodenas E, et al. Mol Biol Cell. 2012 Mar;23(5):930-44.
Proper citation: RRID:WB-STRAIN:WBStrain00003837 Copy
http://www.wormbase.org/db/get?name=WBStrain00003834
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:24490688
Synonyms: lem-2(tm1582) emr-1(RNAi)
Alternate IDs: WB-STRAIN:BN19
Notes: emr-1(RNAi)
Proper citation: RRID:WB-STRAIN:WBStrain00003834 Copy
http://www.wormbase.org/db/get?name=WBStrain00003833
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00017895(vrk-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00017895(vrk-1)
Availability: available
Synonyms: vrk-1(ok1181)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:BN3, CGC_BN3
Notes: F28B12.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1181 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. Klerkx et al, Dev Biol. 2009 335:12-21.
Proper citation: RRID:WB-STRAIN:WBStrain00003833 Copy
http://www.wormbase.org/db/get?name=WBStrain00003968
Source Database: WormBase (WB)
Affected Genes: WBGene00006331(sup-26)
Genomic Alteration: WBGene00006331(sup-26)
Availability: available
Synonyms: sup-26(n1091) III.
Alternate IDs: WB-STRAIN:BW916, CGC_BW916
Notes: Superficially wild-type. Maintain under normal conditions. Reference: Manser J, et al. (2002) Genesis 34(3):184-95.
Proper citation: RRID:WB-STRAIN:WBStrain00003968 Copy
http://www.wormbase.org/db/get?name=WBStrain00003962
Source Database: WormBase (WB)
Affected Genes: WBGene00002999(lin-10)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00002999(lin-10), WBGene00006752(unc-13)
Availability: available
Synonyms: unc-13(e1091) lin-10(e1438) I.
Alternate IDs: WB-STRAIN:BW538, CGC_BW538
Notes: Unc and Vul.
Proper citation: RRID:WB-STRAIN:WBStrain00003962 Copy
http://www.wormbase.org/db/get?name=WBStrain00003961
Source Database: WormBase (WB)
Affected Genes: WBGene00000435(ceh-10)
Genomic Alteration: WBGene00000435(ceh-10)
Availability: available
Source References: PMID:2361334
Synonyms: ceh-10(ct78) III.
Alternate IDs: WB-STRAIN:BW506, CGC_BW506
Notes: Withered tail. Adults shorter than WT. Embryonic cell migrations affected: CAN migration with high penetrance. Previously called mig-11.
Proper citation: RRID:WB-STRAIN:WBStrain00003961 Copy
http://www.wormbase.org/db/get?name=WBStrain00003979
Source Database: WormBase (WB)
Affected Genes: WBGene00006759(unc-22)
Genomic Alteration: WBGene00006759(unc-22)
Availability: available
Source References: PMID:7906415
Synonyms: unc-22(ct171) IV.
Alternate IDs: WB-STRAIN:BW1163, CGC_BW1163
Notes: Mutagen: Trimethylpsoalen|"Twitcher."
Proper citation: RRID:WB-STRAIN:WBStrain00003979 Copy
http://www.wormbase.org/db/get?name=WBStrain00003978
Source Database: WormBase (WB)
Affected Genes: WBGene00006759(unc-22)
Genomic Alteration: WBGene00006759(unc-22)
Availability: available
Source References: PMID:7906415
Synonyms: unc-22(ct169) IV.
Alternate IDs: WB-STRAIN:BW1161, CGC_BW1161
Notes: Mutagen: Trimethylpsoalen|"Twitcher."
Proper citation: RRID:WB-STRAIN:WBStrain00003978 Copy
http://www.wormbase.org/db/get?name=WBStrain00003975
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003184(mei-2)|WBGene00006765(unc-29)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003184(mei-2), WBGene00006765(unc-29)
Availability: available
Source References: PMID:2249759
Synonyms: dpy-5(e61) mei-2(ct102) unc-29(e1072) I; sDp2 (I;f).
Alternate IDs: WB-STRAIN:BW1102, CGC_BW1102
Notes: Animals with the duplication are Unc. Animals that have lost the duplication are DpyUncMel. mei-2 is non-conditional recessive maternal effect lethal.|"Made_by: Mains & Sulston"
Proper citation: RRID:WB-STRAIN:WBStrain00003975 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
