Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00003912
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:22611162
Synonyms: byIs161; bkIs10; nIs52.
Alternate IDs: WB-STRAIN:BR5792
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00003912 Copy
http://www.wormbase.org/db/get?name=WBStrain00003995
Source Database: WormBase (WB)
Affected Genes: WBGene00001077(dpy-18)|WBGene00002645(let-427)|WBGene00006782(unc-46)
Genomic Alteration: WBGene00001077(dpy-18), WBGene00002645(let-427), WBGene00006782(unc-46)
Availability: available
Source References: PMID:1752418
Synonyms: dpy-18(e364)/eT1 III; unc-46(e177) let-427(s1057)/eT1 V.
Alternate IDs: WB-STRAIN:BW1747, CGC_BW1747
Notes: Heterozygotes are WT and segregate WT, Unc-36, Sterile DpyUncs and dead eggs. Maintain by picking WT.|"Mutagen:from BC3006"
Proper citation: RRID:WB-STRAIN:WBStrain00003995 Copy
http://www.wormbase.org/db/get?name=WBStrain00003996
Source Database: WormBase (WB)
Affected Genes: WBGene00001678(gpa-16)|WBGene00001864(him-5)
Genomic Alteration: WBGene00001678(gpa-16), WBGene00001864(him-5)
Availability: available
Synonyms: gpa-16(it143) I; him-5(e1490) V.
Alternate IDs: WB-STRAIN:BW1809, CGC_BW1809
Notes: Made_by: D. Bergmann|"Temperature-sensitve. Maintain at 15C. Slight Maternal Effect Lethal (Mel) at 15C, more pronounced at 20C. Highly penetrant Mel at 25C and a fraction of the survivors have reversed left-right organs."
Proper citation: RRID:WB-STRAIN:WBStrain00003996 Copy
http://www.wormbase.org/db/get?name=WBStrain00003994
Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00006796(unc-62)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00006796(unc-62)
Availability: available
Synonyms: +/eT1 III; unc-62(t2012) dpy-11(e224)/eT1 V.
Alternate IDs: WB-STRAIN:BW1739, CGC_BW1739
Notes: Heterozygotes are wild-type, and segregate WT heterozygotes, Dpy Mel (unc-62 dpy-11 homozygotes), and dead eggs (eT1 homozygotes). unc-62 dpy-11 homozygotes give only dead embryos (96%) or dead larva (4%).|"Made_by: R. Feitchinger"
Proper citation: RRID:WB-STRAIN:WBStrain00003994 Copy
http://www.wormbase.org/db/get?name=WBStrain00003991
Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00003912(pal-1)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00003912(pal-1)
Availability: available
Synonyms: pal-1(ct224)/qC1 [dpy-19(e1259) glp-1(q339)] III.
Alternate IDs: WB-STRAIN:BW1566, CGC_BW1566
Notes: Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct224 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct224 is a 4.2kb deletion removing exon 1 through exon 6 of the pal-1 gene. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
Proper citation: RRID:WB-STRAIN:WBStrain00003991 Copy
http://www.wormbase.org/db/get?name=WBStrain00003929
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:BRC20231
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.
Proper citation: RRID:WB-STRAIN:WBStrain00003929 Copy
http://www.wormbase.org/db/get?name=WBStrain00003922
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:22611162
Synonyms: byIs161; bkIs10; jsIs609.
Alternate IDs: WB-STRAIN:BR6174
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00003922 Copy
http://www.wormbase.org/db/get?name=WBStrain00003920
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:22611162
Synonyms: byIs161; bkIs10; Ex[Punc-129::mCherry].
Alternate IDs: WB-STRAIN:BR6088
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00003920 Copy
http://www.wormbase.org/db/get?name=WBStrain00003921
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:22611162
Synonyms: byIs162; bkIs10; Ex[Punc-129::mCherry]
Alternate IDs: WB-STRAIN:BR6089
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00003921 Copy
http://www.wormbase.org/db/get?name=WBStrain00003938
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001077(dpy-18)|WBGene00001595(gld-1)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001077(dpy-18), WBGene00001595(gld-1), WBGene00006752(unc-13)
Availability: available
Source References: PMID:7713419, PMID:30599151
Synonyms: unc-13(e51) gld-1(q485)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III.
Alternate IDs: WB-STRAIN:BS3156, CGC_BS3156
Notes: Heterozygotes are wild-type and segregate WT heterozygotes, Unc (unc-13 gld-1 homozygotes), and Dpy (hT2 homozygotes; the bli-4 mutation is suppressed by dpy-18). XX Uncs have tumorous germline and are sterile; XO Uncs are cross fertile (though they don't mate due to the Unc mutation). q485 is the canonical allele of gld-1. It behaves like deletions of the locus in complementation tests and thus is genetically null. Molecularly, it is a deletion of 82 bases and fails to produce gld-1 RNA and protein.|"Mutagen: Psoralen"
Proper citation: RRID:WB-STRAIN:WBStrain00003938 Copy
http://www.wormbase.org/db/get?name=WBStrain00003936
Source Database: WormBase (WB)
Affected Genes: WBGene00001609(glp-1)|WBGene00006768(unc-32)|WBGene00006772(unc-36)
Genomic Alteration: WBGene00001609(glp-1), WBGene00006768(unc-32), WBGene00006772(unc-36)
Availability: available
Source References: PMID:9043073
Synonyms: unc-32(e189) glp-1(oz112)/unc-36(e251) glp-1(q175) III.
Alternate IDs: WB-STRAIN:BS913, CGC_BS913
Notes: Heterozygotes are WT and segregate WT and Uncs (both Unc-32 and Unc-36). Tumorous germline phenotype in both hermaphrodites and males; semidominant and temperature sensitive. Even at permissive temperatures (15-20C) brood size is very small (10-20 viable progeny) because of the overproliferation of germ cells at the expense of oogenesis.|"No longer available from the CGC catalogue 24/04/2020"
Proper citation: RRID:WB-STRAIN:WBStrain00003936 Copy
http://www.wormbase.org/db/get?name=WBStrain00003934
Source Database: WormBase (WB)
Affected Genes: WBGene00001482(fog-2)
Genomic Alteration: WBGene00001482(fog-2)
Availability: available
Source References: PMID:32338603, PMID:38967024
Synonyms: fog-2(oz40) V.
Alternate IDs: WB-STRAIN:BS553, CGC_BS553
Notes: Male/female strain. Maintain by mating.|"Mutagen: Psoralen"|"WBStrain mapped, WBPaper00059605 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00003934 Copy
http://www.wormbase.org/db/get?name=WBStrain00003931
Source Database: WormBase (WB)
Affected Genes: WBGene00001595(gld-1)
Genomic Alteration: WBGene00001595(gld-1)
Availability: available
Synonyms: gld-1(q266)/nDf24 I.
Alternate IDs: WB-STRAIN:BS14, CGC_BS14
Notes: Heterozygotes are fertile and grow more slowly than gld-1(q266) homozygotes. gld-1(q266) homozygotes are sterile and produce small abnormal oocytes. nDf24 homozygotes are dead.
Proper citation: RRID:WB-STRAIN:WBStrain00003931 Copy
http://www.wormbase.org/db/get?name=WBStrain00003930
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:BRC20263
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.
Proper citation: RRID:WB-STRAIN:WBStrain00003930 Copy
http://www.wormbase.org/db/get?name=WBStrain00004001
Source Database: WormBase (WB)
Affected Genes: WBGene00000936(dbl-1)
Genomic Alteration: WBGene00000936(dbl-1)
Availability: available
Synonyms: ctIs40 X.
Alternate IDs: WB-STRAIN:BW1940, CGC_BW1940
Notes: ctIs40 [dbl-1(+) + sur-5::GFP]. Lon. dbl-1 over-expressing line from injection of constructs ZC421 and pTG98.
Proper citation: RRID:WB-STRAIN:WBStrain00004001 Copy
http://www.wormbase.org/db/get?name=WBStrain00003948
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00018625(prp-17)
Genomic Alteration: WBGene00000254(bli-4), WBGene00018625(prp-17)
Availability: available
Synonyms: prp-17(oz273) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:BS5431, CGC_BS5431
Notes: Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile oz273 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.|"Made_by: Jessica Kerins"
Proper citation: RRID:WB-STRAIN:WBStrain00003948 Copy
http://www.wormbase.org/db/get?name=WBStrain00003947
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003783(nos-1)|WBGene00003784(nos-2)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003783(nos-1), WBGene00003784(nos-2)
Availability: available
Synonyms: nos-2(ok230) nos-1(gv5)/mIn1 [dpy-10(e128) mIs14] II.
Alternate IDs: WB-STRAIN:BS5351, CGC_BS5351
Notes: Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP nos-2 nos-1 homozygotes (segregate many dead embryos). Pick wild-type dim GFP and check for correct segregation of progeny to maintain. Reference: Hansen D, et al. Development. 2004 Jan;131(1):93-104.
Proper citation: RRID:WB-STRAIN:WBStrain00003947 Copy
http://www.wormbase.org/db/get?name=WBStrain00003945
Source Database: WormBase (WB)
Affected Genes: WBGene00001303(sec-61.G)|WBGene00004855(sma-1)
Genomic Alteration: WBGene00001303(sec-61.G), WBGene00004855(sma-1)
Availability: available
Source References: PMID:8707849
Synonyms: sec-61.G(oz1) sma-1(e30) V/nT1 [unc-?(n754) let-?] (IV;V).
Alternate IDs: WB-STRAIN:BS5182, CGC_BS5182
Notes: Heterozygotes are Unc and segregate Unc, dead eggs and Sma. sec-61.G sma-1 homozygotes grow up to be sterile adults, with endomitotic oocytes in the gonad arm. sec-61.G also known as emo-1.
Proper citation: RRID:WB-STRAIN:WBStrain00003945 Copy
http://www.wormbase.org/db/get?name=WBStrain00003942
Source Database: WormBase (WB)
Affected Genes: WBGene00004057(pmk-3)
Genomic Alteration: WBGene00004057(pmk-3)
Availability: available
Source References: PMID:37310929, PMID:39532199
Synonyms: pmk-3(ok169).
Alternate IDs: WB-STRAIN:BS3383, CGC_BS3383
Notes: F42G8.4. No obvious phenotype. Follow by PCR. Predicted gene is a p38 related Map Kinase. Approx. 1.5 kb deletion by agarose gel (not sequenced so end points not known). Nested PCR primers for detecting F42G8.4: F42G8.4EL1 5' - TCGCCCTTTGTATGTCTTCC - 3'. F42G8.4ER1 5' - TTCTCCAGGGATTAACGGTG - 3'. F42G8.4IL1 5' - TTTTCACTGCGTCTCAATCG - 3'. F42G8.4IR1 5' - TTTCAAATTTGCAGGTGTGC - 3'.|"Made_by: Barstead/Moulder"
Proper citation: RRID:WB-STRAIN:WBStrain00003942 Copy
http://www.wormbase.org/db/get?name=WBStrain00003943
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001077(dpy-18)|WBGene00001595(gld-1)|WBGene00001596(gld-2)|WBGene00001609(glp-1)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001077(dpy-18), WBGene00001595(gld-1), WBGene00001596(gld-2), WBGene00001609(glp-1), WBGene00006768(unc-32)
Availability: available
Synonyms: gld-2(q497) gld-1(q485)/hT2 [dpy-18(h662)] I; unc-32(e189) glp-1(q175)/hT2 [bli-4(e937)] III.
Alternate IDs: WB-STRAIN:BS3392, CGC_BS3392
Notes: Heterozygotes are wild-type and segregate WT heterozygotes, Unc (gld-2 gld-1; unc-32 glp-1 homozygotes), and Dpy (hT2 homozygotes; the bli-4 mutation is suppressed by dpy-18). Check Unc-32 animals for tumors to confirm presence of glp-1 in the line. glp-1(q175) is nonsense R191 > stop (opal).
Proper citation: RRID:WB-STRAIN:WBStrain00003943 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
