Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131954
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct (as of 2017-01-26)
Alternate IDs: 5131954
Notes: This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 18-bp frameshift deletion in exon 2.
Proper citation: RRID:RGD_5131954 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5144105
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 5144105
Notes: This strain was produced by injecting ZFNs targeting the sequence CAGCCCACTCGGCCCggcctcTCCCCGCGCCCGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 3.
Proper citation: RRID:RGD_5144105 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5144103
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 5144103
Notes: This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 4.
Proper citation: RRID:RGD_5144103 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5144102
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 5144102
Notes: This strain was produced by injecting ZFNs targeting the sequence agccacctggtatttgaggagacgcttggagatgac into ACI.FHH(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90) embryos. The result is a 5-bp frameshift deletion in exon 2.
Proper citation: RRID:RGD_5144102 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5144108
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 5144108
Notes: This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 4.
Proper citation: RRID:RGD_5144108 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5144101
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryorecovery (as of 2017-01-26)
Alternate IDs: 5144101
Notes: This strain was produced by injecting ZFNs targeting the sequence GTCTGCAGGCTGCCGCagcaagTACGTGGGCATCTGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 3.
Proper citation: RRID:RGD_5144101 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131094
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 5131094
Notes: Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.
Proper citation: RRID:RGD_5131094 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5143994
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 5143994
Notes: This strain was produced by injecting ZFNs targeting the sequence GCCCGCGTCATCCGAtagcagCACCAAAAGGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 142-bp deletion, overlapping the start codon
Proper citation: RRID:RGD_5143994 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5143996
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-01-26)
Alternate IDs: 5143996
Notes: This strain was produced by injecting ZFNs targeting the sequence ATCCTGGCCCTGGGTgtgtggGCTGTGGCCCAGCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 100-bp mutation deleting part of exon 3 and the splice acceptor.
Proper citation: RRID:RGD_5143996 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131933
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 5131933
Notes: This strain was produced by injecting ZFNs targeting the sequence CGAGTGGGCCATgtgggCCAACGAACAGGCGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 36-bp frameshift deletion in exon 1.
Proper citation: RRID:RGD_5131933 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092575
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2025-03-27)
Alternate IDs: 598092575
Notes: This strain, called KK rats, in homozygous rats show gait abnormalities from around 5-6 weeks of age. Thereafter, the neurological symptoms progress rapidly, leading to emaciation and death. The mutant gene was named kk, as Kenta Kumafuji was the discoverer of the gait abnormality. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092575 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092509
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2025-03-21)
Alternate IDs: 598092509
Notes: Gal-3 KO rats were developed using CRISPR technology on the Sprague-Dawley background (Sage). CRISPR guides were selected targeting the fifth exon, and gene disruption was confirmed by genomic sequencing and immunoblot analysis for Gal-3 protein expression in lung tissue. PMCID: PMC6589585 Availability Contact Email: [email protected] at Augusta University
Proper citation: RRID:RGD_598092509 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092583
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-27)
Alternate IDs: 598092583
Notes: Cre was inserted at the start codon (methionine) of the somatostatin (Sst) gene. The Sst precursor is then expressed using the T2A peptide as a linker. Genetic background is Iar:Long-Evans (Institute for Animal Reproduction). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092583 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092585
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-27)
Alternate IDs: 598092585
Notes: The ES cell line derived from Lister Hooded rats (Seac:LIS), which was established by Prof. Sakimura at Department of Animal Model Development, Brain Research Institute, Niigata University, was used. Cloned ES cells established by introducing a vector of G8CaMP-flox stop at the 3'non-coding site of the Actb gene were injected into fertilized eggs of SD rats (Slc:SD) using a microinjection method. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092585 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092582
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-27)
Alternate IDs: 598092582
Notes: Genetic background is Iar:Long-Evans (Institute for Animal Reproduction). Cre and T2A were inserted into the start codon (methionine) of the second exon of the Calca gene using CRISPR/Cas9. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092582 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598154594
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-04-30)
Alternate IDs: 598154594
Notes: Zinc fingers were designed and human C5aR1 cDNA was cloned into a pZFN plasmid and sequence verified. Subsequently, co-microinjection of a pair of ZFNs and the donor plasmid into the pronucleus of fertilized, one cell embryos was performed, generating HR-mediated KI animals. The entire process was performed at SAGE Labs, Horizon, (St Louis, USA). Sprague Dawley (Charles River) rat (Rattus norvegicus) C5aR1 (NCBI Gene ID: 113959, updated on 18-Oct-2012 Location : 1q12 Sequence : Chromosome: 1; NC_005100.3 (79452051..79458856, complement) mRNA join (1..>34,5088..6806) /gene="C5ar1" CDS join(32..34,5088..6143) /gene="C5ar1") was replaced using zinc finger technology utilizing with the human C5aR1 cDNA by inserting the human cDNA into the 5’ end of the rat C5ar1 exon 2 locus using the ZFN Binding. Cut Site: CTTGGCCGTGTTCCTGGTaggagtTACCGGAAATGCCCTGGTG National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598154594 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092598
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-28)
Alternate IDs: 598092598
Notes: A 29-base deletion was introduced into the first exon of the NADPH oxidase 1 (Nox1) gene of F344/DuCrj rats by CRISPR/Cas9. They were then backcrossed to F344/N (Japan SLC, Inc.). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092598 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092597
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-28)
Alternate IDs: 598092597
Notes: Generated with CRISPR/Cas9 system in the Research Institute, National Cerebral and Cardiovascular Center. Genetic background is Slc:SD. Guide RNA gRNA No1: GACCATCAGTAGTAAGACTA gRNA No2: GATTTCCAGGTACTCGGGACG National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092597 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092526
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2025-03-25)
Alternate IDs: 598092526
Notes: This strain was established in 2020 using the CRISPR/Cas9 system at the Institute of Immunology Co., Ltd. In the same year, it was introduced to the Research Institute, National Cerebral and Cardiovascular Center. The genetic background is Slc:SD. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092526 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=598092522
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2025-03-25)
Alternate IDs: 598092522
Notes: Lyst gene mutation was identified in 1985 in DA rats maintained at Hamamatsu University School of Medicine since 1980. In 2000, it was provided to Japan SLC, Inc.The mutant beige protein was frameshift and prematured truncated at the 2594th amino acids due to 578 bp deletion (positions 7742-8319) caused by recombination between LINE1s (Long Interspersed Nuclear Element 1). National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_598092522 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
