Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
BN-Lx/CubMcwi Resource Report Resource Website |
RRID:RGD_38676495 | Rattus norvegicus | These are re-derived rats of BN-Lx/Cub now maintained at Medical College of Wisconsin. The parent strain was derived by introgressing mutant Lx gene of the polydactylous (PD/Cub) rat onto the BN background. RGD HRDP, contact Hybrid Rat Diversity Program at [email protected] | 38676495 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Embryo (as of 2024-08-06) | 38676495 | RGD | 2026-10-10 01:05:05 | 0 | |||||
|
FHH-Chr 1BN-Add3em2Mcwi /Roman Resource Report Resource Website |
RRID:RGD_150429618 | Rattus norvegicus | ZFN system was used to Knock out the rat Add3 gene of FHH-Chr 1BN/Mcwi rat embryos.The ZFN mRNA was injected into the pronucleus of fertilized FHH-Chr 1BN/Mcwi embryos and transferred to the oviduct of pseudopregnant females. PCR genotyping of tail biopsies confirmed a 68-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'. Founders with Add3 deletion were backcrossed to the parental strain to generate heterozygous F1 rats. Heterozygous F1 siblings were then intercrossed to derive a homozygous KO line used | 150429618 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150429618 | RGD | 2026-10-10 01:05:04 | 0 | |||||
|
WI- Lpar1m1Hubr Resource Report Resource Website |
RRID:RGD_39457945 | Rattus norvegicus | The Lpar1 mutant rat line was generated by target-selected ENU-driven mutagenesis of male MSH6 knockout rats, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats revealed an ENU-induced missense mutation in Lpar1 that resulted in the change of a methionine into an arginine (p.M318R) in the 8th helix and that was predicted to be deleterious for protein function. The founder animal was mated with wild type Msh6 females. The Msh6 mutated allele was eliminated by systematic selection of F2. | 39457945 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 39457945 | RGD | 2026-10-10 01:05:05 | 0 | |||||
|
SD-Adgrl3em1Huyc Resource Report Resource Website |
RRID:RGD_127285661 | Rattus norvegicus | The CRISPR/Cas9 system was used to to delete exon 3 of the rat Adgrl3 (Lphn3). Two sgRNAs targeting the sequences flanking exon 3 (GTCCCTTGCCAGTACATCTC and CCTAGTGTTGTGTTCTGCTA),Cas9 mRNA with the CRISPR/Cas9 reagents was injected into fertilized eggs. Genotyping of founder rats was confirmed by PCR genotyping using three primers: 1. AAAGGGTCATAGCATCCGGC, 2. CTAACGTGGCTTTTTGTCTTCT, and 3. GCTCGACAGACAGTGTGGAT. The WT band occurs at ~320 bp and KO band at ~452 bp. | 127285661 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 127285661 | RGD | 2026-10-10 01:05:06 | 0 | |||||
|
BN-Aireem1Ang-/- Resource Report Resource Website |
RRID:RGD_38599146 | Rattus norvegicus | The homozygous Aire mutant rats are littermates of cross of heterozygotes Aire mutant rats . The mutations created by ZFN reagents targeting to a DNA sequence 59-TGCCACCCAGACCCCCCACAAAGAGAAGAGCCCTGGAAGAG- 39 in exon 3 of the Aire gene. This mutant carries a 17-bp deletion in the nuclear localization signal sequence, causing a premature stop codon. | 38599146 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38599146 | RGD | 2026-10-10 01:05:05 | 0 | |||||
|
SS-Xdhem1Mcwi-/- Resource Report Resource Website |
RRID:RGD_14398479 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 7-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. There was no Xdh protein detected in the kidney cortex tissue of 6-week old homozygous mutants. Contact MCW rat distribution at [email protected] | 14398479 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2024-05-29) | 14398479 | RGD | 2026-10-10 01:05:06 | 0 | |||||
|
SD-Ephx2em2Mcwi Resource Report Resource Website |
RRID:RGD_25394528 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a a 23-bp deletion in exon 3. Contact MCW rat distribution at [email protected] | 25394528 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 25394528 | RGD | 2026-10-10 01:05:05 | 0 | |||||
|
SD-Il2rgem1-/y/Mlit Resource Report Resource Website |
RRID:RGD_38548915 | Rattus norvegicus | The Il2rg knock-out rats were obtained by injecting Il2rg-targeting sgRNA into 1-cell embryos. The resulted mutation is 1-bp insertion (A) at 71169012 position. No protein was detected in the spleen of this Il2rg knock out. | 38548915 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38548915 | RGD | 2026-10-10 01:05:06 | 0 | |||||
|
SD-Mir146bem1Mcwi Resource Report Resource Website |
RRID:RGD_25330093 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a 7-bp deletion in Mir146b. Contact MCW rat distribution at [email protected] | 25330093 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 25330093 | RGD | 2026-10-10 01:05:05 | 0 | |||||
|
SD-Myh7bem1Blar+/+ Resource Report Resource Website |
RRID:RGD_149735898 | Rattus norvegicus | This is the homozygous wild type littermate from crossing of heterozygous SD-Myh7b mutants. The Myh7b knockout SD rats were generated using the CRISPR/Cas9 system targeting exon 2, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. The heterzygous Myh7b+/- rats were crossed to generate littermate controls. The birth ratio of wild type (WT):Myh7b+/-:Myh7b-/- was approximately 1:2:1, indicating that Myh7b-/- did not cause fetal death. | 149735898 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 149735898 | RGD | 2026-10-10 01:05:05 | 0 | |||||
|
SS-Xdhem2Mcwi Resource Report Resource Website |
RRID:RGD_14398481 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 12-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. Contact MCW rat distribution at [email protected] | 14398481 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 14398481 | RGD | 2026-10-10 01:05:06 | 0 | |||||
|
LEW-Glp1rem3Mcwi Resource Report Resource Website |
RRID:RGD_14394491 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 4-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos. Contact MCW rat distribution at [email protected] | 14394491 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2026-02-19) | 14394491 | RGD | 2026-10-10 01:05:05 | 0 | |||||
|
LE-Scn2aem1Mcwi Resource Report Resource Website 1+ mentions |
RRID:RGD_25394530 | Rattus norvegicus | The rat strain was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The mutant allele was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The resulting mutation is net 4-bp deletion in exon 5 comprising a 10-bp deletion (shown in lower case: CTACGGGATccctggaattGGTTGGATTTCACAGTCATT ) and a 6-bp insertion (TTCACT). Autism Rat Model Resource. Contact MCW rat distribution at [email protected] | 25394530 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2025-02-20) | 25394530 | RGD | 2026-10-10 01:05:05 | 2 | |||||
|
SD-Cyp3a23/3a1em1Myliu,Cyp3a2em1Myliu Resource Report Resource Website |
RRID:RGD_14696722 | Rattus norvegicus | This rat strain is a double knock out for Cyp3a23/3a1 and Cyp3a2 created by using CRISPR/Cas9 targeting exons of Cyp3a23/3a1 and Cyp3a2. This strain carries a 22-bp deletion of Cyp3a23/3a1 and a 10-bp deletion of Cyp3a2 on Sprague Dawley background. | 14696722 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 14696722 | RGD | 2026-10-10 01:05:05 | 0 | |||||
|
W-Trpa1em1Kcrd Resource Report Resource Website |
RRID:RGD_38676448 | Rattus norvegicus | This Trpa1-deleted Wistar (background: Crl:WI) strain was generated by using Zinc Finger Nuclease at Kirin Company, Limited in 2013. Exon 22-24, which form ion channel pore required for the activation in Trpa1 gene, was deleted. National BioResource Project for the Rat in Japan | 38676448 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2020-09-17) | 38676448 | RGD | 2026-10-10 01:05:05 | 0 | |||||
|
SD-Ubdem1 Resource Report Resource Website 1+ mentions |
RRID:RGD_126925138 | Rattus norvegicus | This Ubd (FAT10) knockout rat strain was generated using theCRISPR-Cas9 technique in a Sprague Dawley (SD) background. The knockout allele has a 911 bp deletion of exon 2, leading to a truncated protein of Ubd. | 126925138 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126925138 | RGD | 2026-10-10 01:05:06 | 1 | |||||
|
LE-Dyrk1aem1Mcwi Resource Report Resource Website |
RRID:RGD_40818253 | Rattus norvegicus | The rat strain was produced by injecting CRISPR/Cas9 targeting rat Dyrk1a into Crl:LE embryos. The result is a 14-bp deletion in exon 3 Contact MCW rat distribution at [email protected] | 40818253 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 40818253 | RGD | 2026-10-10 01:05:06 | 0 | |||||
|
DA.F344-Dpp4DPPIV/SvH Resource Report Resource Website |
RRID:RGD_41408337 | Rattus norvegicus | Generation of the congenic strain was started with an initial cross between F344/Crl(Wiga)SvH-Dpp4m females, homozygous for the loss-of-function mutation in the Dpp4 gene on RNO3 and a DA/Ztm wild type male rat. The DP4 deficient congenic DA strain is maintained via brother=sister mating | 41408337 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 41408337 | RGD | 2026-10-10 01:05:06 | 0 | |||||
|
W-Phf24em11Iexas Resource Report Resource Website |
RRID:RGD_38676451 | Rattus norvegicus | This strain was establishe by CRISPR-Cas9 system at Osaka University. Target sequence is CCATGGGGGTGTTGATGTCCAAG (CCA is PAM sequence). Back ground strain is Crlj:Wistar (WI). This strain is line No. 11 and has a 128-bp deletion in Phf24 gene. Off-target effects (214 candidate region) have not yet been examined. National BioResource Project for the Rat in Japan | 38676451 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2020-09-17) | 38676451 | RGD | 2026-10-10 01:05:06 | 0 | |||||
|
SS-Prr5em2Mcwi Resource Report Resource Website |
RRID:RGD_14398465 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in the exon 1 of the gene. Contact MCW rat distribution at [email protected] | 14398465 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2019-04-19) | 14398465 | RGD | 2026-10-10 01:05:06 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
