Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
RB1321 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032020 | Caenorhabditis elegans | C56G3.1(ok1439) X. | C56G3.1 Homozygous. Outer Left Sequence: atagaaaggcaaccgggatt. Outer Right Sequence: cggtaagaaagcggaaatga. Inner Left Sequence: gtttgctctttttggtggga. Inner Right Sequence: catcgtccaatacaatgcga. Inner Primer PCR Length: 2408. Deletion Size: 838 bp deletion with a 1 bp insertion. Sequence across breakpoint from Neline Kriek: tggattggtgataatggctgtagtattgattattaataaccatattccaggaa.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00016984(npr-8) | WBGene00016984(npr-8) | WB-STRAIN:WBStrain00032020 | WormBase (WB) | WB | available | WB-STRAIN:RB1321, CGC_RB1321 | WormBase | 2026-10-17 11:41:15 | 1 | |||
|
RB1377 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032076 | Caenorhabditis elegans | acs-17(ok1562) X. | C46F4.2 Homozygous. Outer Left Sequence: ggtcgattcttcgatttcca. Outer Right Sequence: tggggagcataggtttttca. Inner Left Sequence: cctaaaacatatggccaccg. Inner Right Sequence: tgaacgcacggtatgtttgt. Inner Primer PCR Length: 3216. Estimated Deletion Size: about 1700 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00016716(acs-17) | WBGene00016716(acs-17) | WB-STRAIN:WBStrain00032076 | WormBase (WB) | WB | available | WB-STRAIN:RB1377, CGC_RB1377 | WormBase | 2026-10-17 11:41:16 | 1 | |||
|
RB1388 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032086 | Caenorhabditis elegans | ZK1251.1&ins-7(ok1573) IV. | Made_by: Oklahoma KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK1251.1, ZK1251.2. Superficially wild type." | WBGene00002090(ins-7)|WBGene00014240(htas-1) | WBGene00002090(ins-7), WBGene00014240(htas-1) | WB-STRAIN:WBStrain00032086 | WormBase (WB) | WB | available | WB-STRAIN:RB1388, CGC_RB1388 | WormBase | 2026-10-17 11:41:16 | 2 | |||
|
RB1480 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032177 | Caenorhabditis elegans | T05F1.1(ok1731) I. | Made_by: OMRF Knockout Group|"T05F1.1 Homozygous. Outer Left Sequence: cttcaagagtggccatttcc. Outer Right Sequence: cttcaagagtggccatttcc. Inner Left Sequence: tttaatgcgggaaagtgacc. Inner Right Sequence: catgcgtgtgcctttaactg. Inner Primer PCR Length: 2592. Estimated Deletion Size: about 1100 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011488(nra-2) | WBGene00011488(nra-2) | WB-STRAIN:WBStrain00032177 | WormBase (WB) | WB | available | WB-STRAIN:RB1480, CGC_RB1480 | WormBase | 2026-10-17 11:41:18 | 1 | |||
|
RB1485 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032182 | Caenorhabditis elegans | csp-2(ok1742) IV. | Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y73B6BL.7. Homozygous. Outer Left Sequence: GCGACGAAGAATGTTCAGGT. Outer Right Sequence: TTATGTCTTGGTGCGTCTCG. Inner Left Sequence: AGATTGATCGGCTTTGCACT. Inner Right Sequence: AGATGCCGACGTCAATTTTC. Inner Primer PCR Length: 3112 bp. Deletion Size: 1722 bp. Deletion left flank: TTTCCAAATTCATAGGAAAAATACTCTGAA. Deletion right flank: TTGCAAATTCTTGAAAGTAAAGTCAACTTC." | WBGene00000820(csp-2) | WBGene00000820(csp-2) | WB-STRAIN:WBStrain00032182 | WormBase (WB) | WB | available | WB-STRAIN:RB1485, CGC_RB1485 | WormBase | 2026-10-17 11:41:18 | 1 | |||
|
RB1483 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032180 | Caenorhabditis elegans | ifa-4(ok1734) X. | K05B2.3 Homozygous. Outer Left Sequence: atgtttcactttggcggttc. Outer Right Sequence: agagcgaataccgaagctca. Inner Left Sequence: cgagagtaattccgggttca. Inner Right Sequence: tcgcaagatggagaaggact. Inner Primer PCR Length: 2608. Estimated Deletion Size: about 600 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00002052(ifa-4) | WBGene00002052(ifa-4) | WB-STRAIN:WBStrain00032180 | WormBase (WB) | WB | available | WB-STRAIN:RB1483, CGC_RB1483 | WormBase | 2026-10-17 11:41:18 | 1 | |||
|
RB1405 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032103 | Caenorhabditis elegans | Y59H11AL.1(ok1598) IV. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y59H11AL.1 Homozygous. Outer Left Sequence: tggaacacttccccaaactc. Outer Right Sequence: tgatacgggaaaagctacgc. Inner Left Sequence: ggaagcagtttgctctccag. Inner Right Sequence: aattggcagagttgtttcgg. Inner Primer PCR Length: 3299. Estimated Deletion Size: about 2500 bp." | WBGene00022004(npr-22) | WBGene00022004(npr-22) | WB-STRAIN:WBStrain00032103 | WormBase (WB) | WB | available | PMID:37310929 PMID:38446031 |
WB-STRAIN:RB1405, CGC_RB1405 | WormBase | 2026-10-17 11:41:16 | 2 | ||
|
RB1487 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032184 | Caenorhabditis elegans | asm-3(ok1744) IV. | Made_by: OMRF Knockout Group|"Reference WBPaper00059117 added based on published strain data identified by Textpresso literature search."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W03G1.7 Homozygous. Outer Left Sequence: aagccagaattccgtgtttg. Outer Right Sequence: tcgtcctttctctcgcattt. Inner Left Sequence: cttgcactcctcctttccac. Inner Right Sequence: ggtgacagaatgcgaggaat. Inner Primer PCR Length: 3344. Estimated Deletion Size: about 1400 bp." | WBGene00000213(asm-3) | WBGene00000213(asm-3) | WB-STRAIN:WBStrain00032184 | WormBase (WB) | WB | available | PMID:31940482 | WB-STRAIN:RB1487, CGC_RB1487 | WormBase | 2026-10-17 11:41:18 | 2 | ||
|
RB1465 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032163 | Caenorhabditis elegans | C23H3.4(ok1693) II. | C23H3.4. Homozygous. Outer Left Sequence: CCAAATTCCCCACTTACCCT. Outer Right Sequence: CTGAAATTTTGCCACGGATT. Inner Left Sequence: AGCCCAAGCCAATTATCCTT. Inner Right Sequence: AACACGAACTTTGAATCGCC. Inner Primer PCR Length: 3320 bp. Deletion Size: 963 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00016020(sptl-1) | WBGene00016020(sptl-1) | WB-STRAIN:WBStrain00032163 | WormBase (WB) | WB | available | PMID:25437839 | WB-STRAIN:RB1465, CGC_RB1465 | WormBase | 2026-10-17 11:41:17 | 1 | ||
|
RB1473 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032170 | Caenorhabditis elegans | tli-1(ok1724) I. | F25H2.1 Homozygous. Outer Left Sequence: tccagcaagaccttcgaaac. Outer Right Sequence: tgctgaacgtcgtagacagg. Inner Left Sequence: gagccaacaccaagcagaat. Inner Right Sequence: ttacaggtgctcgttggaga. Inner Primer PCR Length: 2848. Estimated Deletion Size: about 600 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006578(tli-1) | WBGene00006578(tli-1) | WB-STRAIN:WBStrain00032170 | WormBase (WB) | WB | available | WB-STRAIN:RB1473, CGC_RB1473 | WormBase | 2026-10-17 11:41:18 | 1 | |||
|
RB1436 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032134 | Caenorhabditis elegans | sulp-1(ok1639) I. | C55B7.6. Homozygous. Outer Left Sequence: CACGTGGTACTGGCAGAAAA. Outer Right Sequence: CGGGTACACCAGCCAATAGT. Inner Left Sequence: AAACACGGAACTTGCCAAAC. Inner Right Sequence: CAAATGTCCGTTCACACCTG. Inner Primer PCR Length: 2950 bp. Deletion Size: 1004 bp. Deletion left flank: ATTTTTTATTCCTCTACATGGGATGCGGTT. Deletion right flank: ACCCTTCTTCAGCAAAAATAATATTTTTTT. Insertion Sequence: CCTCTACATGGGAT.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00016945(sulp-1) | WBGene00016945(sulp-1) | WB-STRAIN:WBStrain00032134 | WormBase (WB) | WB | available | WB-STRAIN:RB1436, CGC_RB1436 | WormBase | 2026-10-17 11:41:17 | 1 | |||
|
RB1498 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032195 | Caenorhabditis elegans | hyl-2(ok1766) X. | K02G10.6 Homozygous. Outer Left Sequence: acgcagtttccaagcatttc. Outer Right Sequence: tccttttcctcctcggtttt. Inner Left Sequence: gggggagtgatggaagaaat. Inner Right Sequence: ttgcaaaccaattgcaagaa. Inner Primer PCR Length: 3075. Estimated Deletion Size: about 1600 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00002044(hyl-2) | WBGene00002044(hyl-2) | WB-STRAIN:WBStrain00032195 | WormBase (WB) | WB | available | WB-STRAIN:RB1498, CGC_RB1498 | WormBase | 2026-10-17 11:41:18 | 1 | |||
|
RB1420 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032118 | Caenorhabditis elegans | rbx-2(ok1617) I. | Made_by: OMRF Knockout Group|"R10A10.2. Homozygous. Outer Left Sequence: CATCTCCACGAGCACTGAAA. Outer Right Sequence: AACAGACGGAAAACGACCAG. Inner Left Sequence: CGGTGGAAAAACTCTGGAAA. Inner Right Sequence: CGTCTCCTCCGAAATTGAAA. Inner Primer PCR Length: 2101 bp. Deletion Size: 759 bp."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00019993(rbx-2) | WBGene00019993(rbx-2) | WB-STRAIN:WBStrain00032118 | WormBase (WB) | WB | available | WB-STRAIN:RB1420, CGC_RB1420 | WormBase | 2026-10-17 11:41:17 | 1 | |||
|
RB1424 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032122 | Caenorhabditis elegans | Y37A1C.1a(ok1621) IV. | Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060638 added based on AFP_Strain data."|"Y37A1C.1a Homozygous. Outer Left Sequence: cgccggatttccactaagta. Outer Right Sequence: gtgacgcttgtgacgagaaa. Inner Left Sequence: aaagtgacgagagccgagaa. Inner Right Sequence: ggcttcacgtgctaaaggag. Inner Primer PCR Length: 3196. Estimated Deletion Size: about 400 bp." | WB-STRAIN:WBStrain00032122 | WormBase (WB) | WB | available | PMID:33216250 | WB-STRAIN:RB1424, CGC_RB1424 | WormBase | 2026-10-17 11:41:17 | 1 | ||||
|
RB1429 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032127 | Caenorhabditis elegans | T27D1.3(ok1626) III. | Made_by: OMRF Knockout Group|"no longer available from the CGC."|"T27D1.3 Homozygous. Outer Left Sequence: tgccctgttgtataccgtga. Outer Right Sequence: agcggcttcaacagacattt. Inner Left Sequence: aatcagttgggatcaccgag. Inner Right Sequence: acctttcccctactgtgcct. Inner Primer PCR Length: 2710. Estimated Deletion Size: about 900 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00012084(npr-15) | WBGene00012084(npr-15) | WB-STRAIN:WBStrain00032127 | WormBase (WB) | WB | available | PMID:38446031 | WB-STRAIN:RB1429, CGC_RB1429 | WormBase | 2026-10-17 11:41:17 | 2 | ||
|
RB1603 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032298 | Caenorhabditis elegans | klf-3(ok1975) II. | F54H5.4. Homozygous. Outer Left Sequence: CCGAAAGAGAGTGAAGACGG. Outer Right Sequence: TTTGTTGTTCCTCCAGGTCC. Inner Left Sequence: AAAGCAAAAATGACATCGCC. Inner Right Sequence: GCAAAAGAGGATGGGAATCA. Inner Primer PCR Length: 2642 bp. Deletion Size: 1658 bp. Deletion left flank: TAGAAATCCACCATATTATACGGAAGTGAC. Deletion right flank: TACATCAAGCGAGCGATCGCCACTGCAGCG. klf-3 was formerly known as mua-1.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003480(klf-3) | WBGene00003480(klf-3) | WB-STRAIN:WBStrain00032298 | WormBase (WB) | WB | available | WB-STRAIN:RB1603, CGC_RB1603 | WormBase | 2026-10-17 11:41:20 | 2 | |||
|
RB1523 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032219 | Caenorhabditis elegans | C24G7.1(ok1822) I. | C24G7.1 Homozygous. Outer Left Sequence: gcgtgagagagcatgtgaac. Outer Right Sequence: cttcaaattcccgttccaaa. Inner Left Sequence: cttgtttgccaatgcctttt. Inner Right Sequence: ttttccggtcgaattttcag. Inner Primer PCR Length: 3302. Estimated Deletion Size: about 1000 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00016063(delm-2) | WBGene00016063(delm-2) | WB-STRAIN:WBStrain00032219 | WormBase (WB) | WB | available | PMID:37118502 PMID:37500635 |
WB-STRAIN:RB1523, CGC_RB1523 | WormBase | 2026-10-17 11:41:18 | 1 | ||
|
RB1578 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032274 | Caenorhabditis elegans | nhr-69(ok1926) I. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T23H4.2. Homozygous. Outer Left Sequence: TGCTTTAACGGACGAGTTCA. Outer Right Sequence: ACACCCATCATACGCTCTCC. Inner Left Sequence: AAAGCACAAAAGAAATCCGC. Inner Right Sequence: TCTATGTTTTCCACCCTGGC. Inner Primer PCR Length: 2476 bp. Deletion Size: 1329 bp. Deletion left flank: GTCATTTTTTAAAAAAGAAAGTATGAAACA. Deletion right flank: GAATATATCGCATTTTTTGTTTTATTGGAA."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003659(nhr-69) | WBGene00003659(nhr-69) | WB-STRAIN:WBStrain00032274 | WormBase (WB) | WB | available | WB-STRAIN:RB1578, CGC_RB1578 | WormBase | 2026-10-17 11:41:19 | 3 | |||
|
RB1592 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032288 | Caenorhabditis elegans | nhr-64(ok1957) I. | C45E1.1. Homozygous. Outer Left Sequence: AAATTCGTGTCGAAAATGCC. Outer Right Sequence: GTGGACGGTGTGATCACTTG. Inner Left Sequence: GGGATAGAATTCGACCAGCA. Inner Right Sequence: ATCGTTGCATTTAAGGTGGC. Inner Primer PCR Length: 2771 bp. Deletion Size: 1348 bp. Deletion left flank: AATCACTACCTTATGAAGGTCGAATGAGCA. Deletion right flank: AAATCAATTTCGAACTCAGTTTTCAAATTC.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003654(nhr-64) | WBGene00003654(nhr-64) | WB-STRAIN:WBStrain00032288 | WormBase (WB) | WB | available | WB-STRAIN:RB1592, CGC_RB1592 | WormBase | 2026-10-17 11:41:19 | 1 | |||
|
RB1559 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032255 | Caenorhabditis elegans | acr-2(ok1887) X. | K11G12.2. Homozygous. Outer Left Sequence: GGGTCCGTCCTTTAGACCAT. Outer Right Sequence: TGTTGTTGCTGGAGCAATTC. Inner Left Sequence: CCCTGCATATGTGTGAAACG. Inner Right Sequence: CGCTTTTCCAGTTTTTGACC. Inner Primer PCR Length: 3281 bp. Deletion Size: 2857 bp. Deletion left flank: AAAGAAGTGAAGCGGCTCTACCACCCCGAC. Deletion right flank: AGAAATCATGTTTGGAAAACAAAAATATTG.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000042(acr-2) | WBGene00000042(acr-2) | WB-STRAIN:WBStrain00032255 | WormBase (WB) | WB | available | WB-STRAIN:RB1559, CGC_RB1559 | WormBase | 2026-10-17 11:41:19 | 1 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
