Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Background:mutant (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

1,458 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Authority Record Last Update Mentions Count
KHR/Kyo-/-
 
Resource Report
Resource Website
RRID:RGD_7800702 Rattus norvegicus Kaken hairless rat were detected by Kimura from Gunn's rat at Kaken Pharmaceuticals in 1987. 2002 introduced to Kyoto University (F36). National BioResource Project for the Rat in Japan 7800702 mutant Rat Genome Database (RGD) RGD Cryopreserved Embryo; Cryopreserved Sperm 7800702 RGD 2026-09-26 02:42:03 0
SS-Slc7a9em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_7364881 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 6. 7364881 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2017-01-26) 7364881 RGD 2026-09-26 02:42:04 0
SS-Sorcs2em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_7364882 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 34-bp frameshift deletion in exon 15. 7364882 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2017-01-26) 7364882 RGD 2026-09-26 02:42:04 0
SS-Cst3em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_7364880 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence CTTCGCCGTAAGCGAGTAcaacaaGGGCAGCAACGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 18-bp deletion in exon 1. 7364880 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2017-01-26) 7364880 RGD 2026-09-26 02:42:04 0
LE-Park7em1Sage-/-
 
Resource Report
Resource Website
RRID:RGD_7241055 Rattus norvegicus ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous. The resulting mutation is a 9-bp deletion with 1-bp insertion in exon 5 (TTGGTGAAGA). Horizon Discovery 7241055 mutant Rat Genome Database (RGD) RGD Live Animals (as of 2017-05-08) 7241055 RGD 2026-09-26 02:42:03 0
LE-Prknem1Sage
 
Resource Report
Resource Website
RRID:RGD_7241058 Rattus norvegicus This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 4. Sigma Advanced Genetic Engineering Labs 7241058 mutant Rat Genome Database (RGD) RGD Unknown 7241058 RGD 2026-09-26 02:42:03 0
LE-Lrrk1em1Sage-/-Lrrk2em1Sage-/-
 
Resource Report
Resource Website
RRID:RGD_7241053 Rattus norvegicus ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous Horizon Discovery 7241053 mutant Rat Genome Database (RGD) RGD Unknown 7241053 RGD 2026-09-26 02:42:03 0
LE-Prknem1Sage-/-
 
Resource Report
Resource Website
RRID:RGD_7241052 Rattus norvegicus ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous. The resulting mutation is a 5-bp frameshift deletion in exon 4 (TCAGT). Horizon Discovery 7241052 mutant Rat Genome Database (RGD) RGD Unknown 7241052 RGD 2026-09-26 02:42:03 0
LE-Lrrk1em1Sage
 
Resource Report
Resource Website
RRID:RGD_7241051 Rattus norvegicus This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 4. Horizon Discovery 7241051 mutant Rat Genome Database (RGD) RGD Unknown 7241051 RGD 2026-09-26 02:42:03 0
W-LeprfaNin
 
Resource Report
Resource Website
RRID:RGD_8655992 Rattus norvegicus The spontaneously developed obese rat was derived from the colony of inbred W/Nin by selective breeding. Its lean litter mate ( W-Lepr+/+/Nin, RGD:8655977) was used as a control strain in obesity related study. 8655992 mutant Rat Genome Database (RGD) RGD Unknown 8655992 RGD 2026-09-26 02:42:04 0
SS-Apoeem9Mcwi
 
Resource Report
Resource Website
RRID:RGD_7364879 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 101-bp deletion in exon 2 and intron 3 7364879 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2017-01-26) 7364879 RGD 2026-09-26 02:42:04 0
SD-Rag1em1Ang
 
Resource Report
Resource Website
RRID:RGD_7204136 Rattus norvegicus This strain was produced by injecting ZFNs into Sprague-Dawley rat embryos. The resulting mutation is a 5-bp frameshift deletion in the Rag1 gene that predicts a protein with a normal sequence up to aa 245, followed by 5 aa from the insertions and mutations, followed by a stop codon in position 751. 7204136 mutant Rat Genome Database (RGD) RGD Unknown 7204136 RGD 2026-09-26 02:42:03 0
F344-Sv2am1Kyo
 
Resource Report
Resource Website
RRID:RGD_7800671 Rattus norvegicus Established by ENU mutagenesis. A missense mutation (L174Q) mutation in Sv2a: synaptic vesicle glycoprotein 2a, was identified. National BioResource Project for the Rat in Japan 7800671 mutant Rat Genome Database (RGD) RGD Unknown 7800671 RGD 2026-09-26 02:42:04 0
KFRS2/Kyo-/+
 
Resource Report
Resource Website
RRID:RGD_7800673 Rattus norvegicus A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac. National BioResource Project for the Rat in Japan 7800673 mutant Rat Genome Database (RGD) RGD Live Animals; Cryopreserved Sperm 7800673 RGD 2026-09-26 02:42:04 0
F344.Cg-Foxn1rnuKyo-/+
 
Resource Report
Resource Website
RRID:RGD_7800667 Rattus norvegicus Jic N13 to Kyo (1988) National BioResource Project for the Rat in Japan 7800667 mutant Rat Genome Database (RGD) RGD Live Animals; Cryopreserved Sperm 7800667 RGD 2026-09-26 02:42:05 0
TM-Il2rgem5Kyo
 
Resource Report
Resource Website
RRID:RGD_9685754 Rattus norvegicus This strain shows severe combined immunodeficiency caused by a zinc finger nuclease induced 653-bp deletion in Il2rg gene of TM/Kyo embryo. The rats grow normally under SPF condition. National BioResource Project for the Rat in Japan 9685754 mutant Rat Genome Database (RGD) RGD Unknown 9685754 RGD 2026-09-26 02:42:05 0
TM-Il2rgem4Kyo
 
Resource Report
Resource Website
RRID:RGD_9685752 Rattus norvegicus The severe combined immunodeficiency strain carries a zinc finger nuclease-induced 162-bp deletion mutation in rat Il2rg gene. Grows normally under SPF condition. National BioResource Project for the Rat in Japan 9685752 mutant Rat Genome Database (RGD) RGD Unknown 9685752 RGD 2026-09-26 02:42:05 0
SS.BN-(D13Rat25-rs106935835)-Btg2em7Mcwi
 
Resource Report
Resource Website
RRID:RGD_10054307 Rattus norvegicus The Btg2 mutant rats were generated using transcription activator-like effector nuclease (TALEN) constructs specific for the rat Btg2 gene designed to target exon 1 using the target sequence TAGGTTTCCTCACCAGTCtcctgaggactcggggcTGCGTGAGCGAGCAGAGA. The result was a 44-bp deletion mutation in exon 1 (RNO13:50,916,769-50,916,812; aaaccttgagtctctgctcgctcacgcagccccgagtcctcagg) of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos. Contact MCW rat distribution at [email protected] 10054307 mutant Rat Genome Database (RGD) RGD Live Animals; Cryopreserved Sperm (as of 2021-11-03) 10054307 RGD 2026-09-26 02:42:06 0
LEW-Pkd1em3Mcwi
 
Resource Report
Resource Website
RRID:RGD_10054433 Rattus norvegicus CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/NCrl rat embryos. The resulting mutation is a 12-bp deletion in the Pkd1 gene. Contact MCW rat distribution at [email protected] 10054433 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2018-10-22) 10054433 RGD 2026-09-26 02:42:06 0
SD-Drd1em1Ionsz
 
Resource Report
Resource Website
RRID:RGD_11073719 Rattus norvegicus CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A-Chr2-EYFP behind the stop codon of Drd1. Institute of Neuroscience, Chinese Academy of Sciences 11073719 mutant Rat Genome Database (RGD) RGD Unknown 11073719 RGD 2026-09-26 02:42:06 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.