Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
rol-8(wrd230[rol-8mNG::3xFLAG]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062632 | Caenorhabditis elegans | rol-8(wrd230[rol-8mNG::3xFLAG]) II. | Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous rol-8 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. | WBGene00004398(rol-8) | WBGene00004398(rol-8) | WB-STRAIN:WBStrain00062632 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:10 | 0 | ||||
|
unc-119(ed3) III; aak-2(ok524) X; fphIs1. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062596 | Caenorhabditis elegans | unc-119(ed3) III; aak-2(ok524) X; fphIs1. | fphIs1 [aak-2Ap::aak-2A::GFP + unc-119(+)]. aak-2A isoform expressed with its own promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384. | WBGene00006843(unc-119)|WBGene00020142(aak-2) | WBGene00006843(unc-119), WBGene00020142(aak-2) | WB-STRAIN:WBStrain00062596 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:09 | 0 | ||||
|
unc-119(ed3) III; aak-2(ok524) X; fphEx1. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062597 | Caenorhabditis elegans | unc-119(ed3) III; aak-2(ok524) X; fphEx1. | fphEx1 [aak-2Cp::aak-2C::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. aak-2C isoform expressed from its own promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384. | WBGene00006843(unc-119)|WBGene00020142(aak-2) | WBGene00006843(unc-119), WBGene00020142(aak-2) | WB-STRAIN:WBStrain00062597 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:09 | 0 | ||||
|
dpy-4(wrd228[dpy-4::mNG::3xFLAG]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062630 | Caenorhabditis elegans | dpy-4(wrd228[dpy-4::mNG::3xFLAG]) IV. | Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous dpy-4 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. | WBGene00001066(dpy-4) | WBGene00001066(dpy-4) | WB-STRAIN:WBStrain00062630 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:10 | 0 | ||||
|
cut-2(wrd233[cut-2::mNG::3xFLAG]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062635 | Caenorhabditis elegans | cut-2(wrd233[cut-2::mNG::3xFLAG]) V. | Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous cut-2 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. | WBGene00009983(cut-2) | WBGene00009983(cut-2) | WB-STRAIN:WBStrain00062635 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:10 | 0 | ||||
|
nas-37(wrd106[nas-37:::mNG::3xFLAG]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062628 | Caenorhabditis elegans | nas-37(wrd106[nas-37:::mNG::3xFLAG]) X. | Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous nas-37 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. | WBGene00003553(nas-37) | WBGene00003553(nas-37) | WB-STRAIN:WBStrain00062628 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:10 | 0 | ||||
|
cpz-1(wrd128[cpz-1::mNG::3xFLAG::linker]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062629 | Caenorhabditis elegans | cpz-1(wrd128[cpz-1::mNG::3xFLAG::linker]) I. | Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in exon 4 of the endogenous cpz-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. | WBGene00000788(cpz-1) | WBGene00000788(cpz-1) | WB-STRAIN:WBStrain00062629 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:10 | 0 | ||||
|
K02D10.1(bet88) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062626 | Caenorhabditis elegans | K02D10.1(bet88) III. | Homozygous viable. Deletion of 2796 bp in parental strain N2. Left flanking sequence: tatgaactttaagaccaact; Right flanking sequence: ggatgggatgcaactgttgc. sgRNA #1: actcatactataagttcagt; sgRNA #2: ctacttgggcaaagccagga.|"Made_by: Bettinger lab" | WB-STRAIN:WBStrain00062626 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:10 | 0 | ||||||
|
mir-43(sjm2) II; ebax-1(tm2321) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062580 | Caenorhabditis elegans | mir-43(sjm2) II; ebax-1(tm2321) IV. | Homozygotes lack gross phenotypes, though some miRNAs are elevated due to loss-of-function mutation in ebax-1. mir-43(sjm2) has positions 9-23 of miR-43 substituted for random sequence. This strain also has a G>T point substitution at position 8 of miR-42. Generated by mating parental strain CZ9907 hermaphrodites to mir-43(sjm2) males. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.|"Made_by: Michael Stubna" | WBGene00003271(mir-43)|WBGene00004140(ebax-1) | WBGene00003271(mir-43), WBGene00004140(ebax-1) | WB-STRAIN:WBStrain00062580 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:09 | 0 | ||||
|
cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062583 | Caenorhabditis elegans | cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. | cshIs128 [rpl-28p::TIR1::T2A::mCherry::HIS-11)] II. Endogenously tagged LIN-12::mNG::3xFlag::AID crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1 with nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.|"Made_by: Taylor Medwig-Kinney and Theresa Gibney" | WBGene00002246(lag-2)|WBGene00003001(lin-12) | WBGene00002246(lag-2), WBGene00003001(lin-12) | WB-STRAIN:WBStrain00062583 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:09 | 0 | ||||
|
lin-12(ljf31[lin-12::mNeonGreen[C1]::loxP::3xFLAG]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062582 | Caenorhabditis elegans | lin-12(ljf31[lin-12::mNeonGreen[C1]::loxP::3xFLAG]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. | Endogenously-tagger reporters allow simultaneous visualization of endogenous LIN-12 localization and lag-2 expression levels. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.|"Made_by: Taylor Medwig-Kinney and Ariel Pani" | WBGene00002246(lag-2)|WBGene00003001(lin-12) | WBGene00002246(lag-2), WBGene00003001(lin-12) | WB-STRAIN:WBStrain00062582 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:09 | 0 | ||||
|
cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::LoxP::3xFLAG::AID]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062585 | Caenorhabditis elegans | cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::LoxP::3xFLAG::AID]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. | cshIs128 [rpl-28p::TIR1::T2A::mCherry::his-11)] II. Auxin-dependent degradation of endogenous LIN-12 with visible readout of endogenous lag-2 expression. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.|"Made_by: Theresa Gibney and Taylor Medwig-Kinney" | WBGene00002246(lag-2)|WBGene00003001(lin-12) | WBGene00002246(lag-2), WBGene00003001(lin-12) | WB-STRAIN:WBStrain00062585 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:09 | 0 | ||||
|
cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00062586 | Caenorhabditis elegans | cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. | cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Allows for conditional degradation of endogenous LIN-12 using 5-Ph-IAA. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.|"Made_by: Theresa Gibney and Taylor Medwig-Kinney" | WBGene00002246(lag-2)|WBGene00003001(lin-12) | WBGene00002246(lag-2), WBGene00003001(lin-12) | WB-STRAIN:WBStrain00062586 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:09 | 1 | ||||
|
Y116F11B.14(bet83) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062625 | Caenorhabditis elegans | Y116F11B.14(bet83) V. | Homozygous viable. Deletion of 1493 bp in parental strain N2. Left flanking sequence: attaatttttgaatttcctaca; Right flanking sequence: tgacgggctaatattgaatta. sgRNA #1: attacactataataatgtgt; sgRNA #2: aaacgacaaactcattatga.|"Made_by: Bettinger lab" | WB-STRAIN:WBStrain00062625 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:10 | 0 | ||||||
|
algn-12(bet74) V/nT1[qls51] (IV;V). Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062622 | Caenorhabditis elegans | algn-12(bet74) V/nT1[qls51] (IV;V). | Homozygous sterile. Balanced by nT1[qIs51]. Deletion of 3471 bp in parental strain N2. Left flanking sequence: tgatcactcacagttccctgg; Right flanking sequence: gaatggatatgatgatgtatat. sgRNA #1: atgttcgtggaacgacacca; sgRNA #2: aggataaactctctcttgaa.|"Made_by: Bettinger lab" | WBGene00022629(algn-12) | WBGene00022629(algn-12) | WB-STRAIN:WBStrain00062622 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:10 | 0 | ||||
|
Y76A2B.4(bet65) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062617 | Caenorhabditis elegans | Y76A2B.4(bet65) III. | Homozygous viable. Deletion of 1579 bp in parental strain N2. Left flanking sequence: gcaaaaaaaaacataccaga; Right flanking sequence: cgtggtttcaggccattacg. sgRNA #1: cctcactgatgatcgtcatc; sgRNA #2: aaaggttcagcattcacacg.|"Made_by: Bettinger lab" | WB-STRAIN:WBStrain00062617 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:10 | 0 | ||||||
|
chil-11(bet66) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062618 | Caenorhabditis elegans | chil-11(bet66) IV. | Homozygous viable. Deletion of 2532 bp in parental strain N2. Left flanking sequence: agtcaattcggaactccatgt; Right flanking sequence: tctacggtttaaacaactcctc. sgRNA #1: aacgggatctgttcatcaca; sgRNA #2: agtgtgaaacgcaacgtcta.|"Made_by: Bettinger lab" | WBGene00016665(chil-11) | WBGene00016665(chil-11) | WB-STRAIN:WBStrain00062618 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:10 | 0 | ||||
|
Y67H2A.2(bet63) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062616 | Caenorhabditis elegans | Y67H2A.2(bet63) IV. | Homozygous viable. Deletion of 2572 bp in parental strain N2. Left flanking sequence: atctatttttttaaggccgaac; Right flanking sequence: tattggcagcaagcgttgcgaa. sgRNA #1: ccatacgttgttgtggagtt; sgRNA #2: tgtgaagcggaaaaccctat.|"Made_by: Bettinger lab" | WB-STRAIN:WBStrain00062616 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:10 | 0 | ||||||
|
dmaEx617. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062572 | Caenorhabditis elegans | dmaEx617. | dmaEx617 [fshr-1p::fshr-1::GFP + unc-54p::mCherry]. Pick mCherry+ animals to maintain. Extrachromosomal fshr-1p::fshr-1::GFP translation reporter. Reference: Wang C, et al. Aging Cell. 2023 Jan;22(1):e13735. doi: 10.1111/acel.13735. PMID: 36415159.|"Made_by: Dengke Ma Lab" | WB-STRAIN:WBStrain00062572 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:09 | 0 | ||||||
|
mir-43(sjm1) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062576 | Caenorhabditis elegans | mir-43(sjm1) II. | Homozygotes lack obvious gross phenotypes; miR-43(sjm1) accumulates in L4 larvae compared to wild-type miR-43. mir-43(sjm1) has an inversion of the miR-43 seed sequence. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.|"Made_by: Michael Stubna" | WBGene00003271(mir-43) | WBGene00003271(mir-43) | WB-STRAIN:WBStrain00062576 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:09 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
