Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
mir-43(sjm2) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062577 | Caenorhabditis elegans | mir-43(sjm2) II. | Homozygotes lack obvious gross phenotypes. mir-43(sjm2) has positions 9-23 of miR-43 substituted for random sequence. This strain is also homozygous for a G>T point substitution at position 8 of miR-42. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.|"Made_by: Michael Stubna" | WBGene00003271(mir-43) | WBGene00003271(mir-43) | WB-STRAIN:WBStrain00062577 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:09 | 0 | ||||
|
Caenorhabditis sp. 78 wild isolate. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062610 | Caenorhabditis sp. 78 | Caenorhabditis sp. 78 wild isolate. | Made_by: Marie-Anne Felix and Hagus Tarno's lab|"Male-female. Maintain at 20C or warmer. Elegans group. Isofemale line isolated from rotting flowers of Stewartia pseudocamellia collected near Malino, South Sulawesi, Indonesia, on 6 May 2024. GPS -5.242944, 119.868592. Reference: Devi, et al., in preparation." | WB-STRAIN:WBStrain00062610 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:10 | 0 | ||||||
|
Caenorhabditis sp. 80 wild isolate. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062613 | Caenorhabditis sp. 80 | Caenorhabditis sp. 80 wild isolate. | Made_by: Marie-Anne Felix and Hagus Tarno's lab|"Male-female. Maintain at 20C or warmer. Elegans group. Isofemale line isolated from rotting wild Musa pseudostems collected in the forest on the road between Bromo and Malang, East Java, Indonesia, on 11 May 2024. GPS -7.99746, 112.87387. Reference: Devi, et al., in preparation." | WB-STRAIN:WBStrain00062613 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:10 | 0 | ||||||
|
nhr-31(ye123) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062614 | Caenorhabditis elegans | nhr-31(ye123) IV. | Made_by: Youmie Kim|"Maintain at 15C. Temperature-sensitive: slow growth rate, reduced brood size. Resistant to Cry proteins. Isolated from EMS screen in N2 background. Reference: Kim YM, et al. PLoS Pathog. 2024 Oct 18;20(10):e1012611. doi: 10.1371/journal.ppat.1012611. PMID: 39423230." | WBGene00003625(nhr-31) | WBGene00003625(nhr-31) | WB-STRAIN:WBStrain00062614 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:10 | 0 | ||||
|
mir-43(sjm1) II; ebax-1(tm2321) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062579 | Caenorhabditis elegans | mir-43(sjm1) II; ebax-1(tm2321) IV. | Homozygotes lack obvious gross phenotypes, though some miRNAs are elevated due to a loss-of-function mutation in ebax-1. mir-43(sjm1) is an inversion of the seed sequence of miR-43. Generated by mating parental strain CZ9907 hermaphrodites to mir-43(sjm1) males. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.|"Made_by: Michael Stubna" | WBGene00003271(mir-43)|WBGene00004140(ebax-1) | WBGene00003271(mir-43), WBGene00004140(ebax-1) | WB-STRAIN:WBStrain00062579 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:09 | 0 | ||||
|
tdp-1(tgx58) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062607 | Caenorhabditis elegans | tdp-1(tgx58) I. | Made_by: nVivo Biosystems/ Nemametrix and Hart lab|"Null allele. CRISPR-engineered deletion of the tdp-1 locus precisely eliminates all known tdp-1 exons and introns. Reference: Lins J, et al. Generation of a C. elegans tdp-1 null allele and humanized TARDBP containing human disease-variants. MicroPubl Biol. 2023 Jun 6;2023:10.17912/micropub.biology.000693. doi: 10.17912/micropub.biology.000693. PMID: 37351305." | WBGene00006514(tdp-1) | WBGene00006514(tdp-1) | WB-STRAIN:WBStrain00062607 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:10 | 0 | ||||
|
hmg-5(xn107[hmg-5::gfp]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062604 | Caenorhabditis elegans | hmg-5(xn107[hmg-5::gfp]) IV. | GFP-tagged HMG-5/TFAM labels mtDNA nucleoids. GFP tag causes a reduction in number of mtDNAs. Reference: Schwartz AZA, et al. eLife. 2022 Oct 6:11:e80396. doi: 10.7554/eLife.80396. PMID: 36200990.|"Made_by: Aaron Schwartz" | WBGene00001975(hmg-5) | WBGene00001975(hmg-5) | WB-STRAIN:WBStrain00062604 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:10 | 0 | ||||
|
rike-1(syb1165) V/nT1[qIs51] (IV;V). Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062608 | Caenorhabditis elegans | rike-1(syb1165) V/nT1[qIs51] (IV;V). | Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP rike-1(syb1165) homozygotes (early larval lethality). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Cheng X, et al. Autophagy. 2023 Jan;19(1):241-255. doi: 10.1080/15548627.2022.2071381. PMID: 35521960.|"Made_by: SunyBiotech" | WBGene00008266(rike-1) | WBGene00008266(rike-1) | WB-STRAIN:WBStrain00062608 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:10 | 0 | ||||
|
Caenorhabditis sp. 77 wild isolate. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062609 | Caenorhabditis sp. 77 | Caenorhabditis sp. 77 wild isolate. | Made_by: Marie-Anne Felix and Hagus Tarno's lab|"Male-female. Maintain at 20C or warmer. Elegans group. Isofemale line isolated from rotting banana flowers collected in a forest near Batu, East Java, Indonesia, on 28 Apr 2024. GPS -7.803387, 112.516604. Reference: Devi, et al., in preparation." | WB-STRAIN:WBStrain00062609 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:10 | 0 | ||||||
|
ahcy-1(syb748) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062562 | Caenorhabditis elegans | ahcy-1(syb748) I. | ahcy-1(syb748) is a CRISPR/Cas9-engineered C280A substitution that eliminates electrophile sensing but retains enzymatic activity.|"Made_by: SunyBiotech Co., Ltd" | WBGene00019322(ahcy-1) | WBGene00019322(ahcy-1) | WB-STRAIN:WBStrain00062562 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:09 | 0 | ||||
|
col-12::mNG(ju1932) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062566 | Caenorhabditis elegans | col-12::mNG(ju1932) V. | Made_by: Jennifer Gotenstein Adams|"mNG inserted at C-terminus of endogenous col-12 locus." | WBGene00000601(col-12) | WBGene00000601(col-12) | WB-STRAIN:WBStrain00062566 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:09 | 0 | ||||
|
lin-15AB(n765) X; wzIs20. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062603 | Caenorhabditis elegans | lin-15AB(n765) X; wzIs20. | wzIs20 [lgc-55p::GFP + lin-15(+)]. lgc-55 regulatory sequences drive expression of GFP in neurons, GLR cells and some muscles. Reference: Ringstad N, et al. Science. 2009;325(5936):96-100. doi:10.1126/science.1169243 | WBGene00003004(lin-15) | WBGene00003004(lin-15) | WB-STRAIN:WBStrain00062603 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:10 | 0 | ||||
|
unc-119(ed3) III; aak-2(ok524) X; fphIs3. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062601 | Caenorhabditis elegans | unc-119(ed3) III; aak-2(ok524) X; fphIs3. | fphIs3 [rab-3p::aak-2A::GFP + unc-119(+)]. aak-2A isoform expressed from the neuronal rab-3 promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384. | WBGene00006843(unc-119)|WBGene00020142(aak-2) | WBGene00006843(unc-119), WBGene00020142(aak-2) | WB-STRAIN:WBStrain00062601 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:09 | 0 | ||||
|
twk-35(mac531) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062551 | Caenorhabditis elegans | twk-35(mac531) V. | Made_by: Chuanman Zhou|"twk-35 loss-of-function allele. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723." | WBGene00006687(twk-35) | WBGene00006687(twk-35) | WB-STRAIN:WBStrain00062551 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:09 | 0 | ||||
|
rexEx7. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062555 | Caenorhabditis elegans | rexEx7. | Made_by: SunyBiotech Co., Ltd|"rexEx7 [gpa-4p::gfp::halo + mec-7p::mRFP]. Pick fluorescent worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Green fluorescence in two ASI neurons." | WB-STRAIN:WBStrain00062555 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:09 | 0 | ||||||
|
dvIs19 III; rexEx11. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062559 | Caenorhabditis elegans | dvIs19 III; rexEx11. | dvIs19 [gst-4p::GFP::NLS] III. rexEx11 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of Halo::TEV::Keap1 protein. Oxidative stress induces expression of GFP. Superficially wild-type.|"Made_by: Marcus J. C. Long" | WB-STRAIN:WBStrain00062559 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:09 | 0 | ||||||
|
qSi423 II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062705 | Caenorhabditis elegans | qSi423 II. | qSi423 [gld-1p::GFP::H2B::gld-1 3'UTR(FBEa TGT to ACA & FBEa* TGT to ACA)[*rajSi50] + Cbr-unc-119(+)] II. Modification of gld-1 FBEa and FBEa* in gld-1 3'UTR of single-copy insertion transgene. Qiu et al., in preparation. | WB-STRAIN:WBStrain00062705 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:11 | 0 | ||||||
|
rajSi50 II; unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062706 | Caenorhabditis elegans | rajSi50 II; unc-119(ed3) III. | Made_by: Kathrin Theil|"rajSi50 [gld-1p::GFP::H2B::gld-1 3'UTR + Cbr-unc-119(+)] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. GFP is visible in germline nuclei, low in distal germ cells, increases proximally, strong in oocytes. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa: slc314 GTCACCAAGTACACTTCCAGCAAG / slc311 TGGCAACATGATGTATGGCACA (100 bp band in FBEa wt). FBEb: slc314 GTCACCAAGTACACTTCCAGCAAG / slc304 GGGTTAGCGTTAAGATAACACA (~500 bp band in FBEb wt). References: Theil K, et al. Nature Commun. 2019 Sep 16;10(1):4205. doi: 10.1038/s41467-019-12050-7. PMID: 31527589. Carrick BH, et al. Dev Cell. 2024. PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans." | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00062706 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:11 | 0 | ||||
|
fbf-1(ok91) fbf-2(q1291[*q973])/mIn1 [mIs14 dpy-10(e128)] II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062704 | Caenorhabditis elegans | fbf-1(ok91) fbf-2(q1291[*q973])/mIn1 [mIs14 dpy-10(e128)] II. | Made_by: Brian Carrick|"Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered Y479E substitution. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain." | WBGene00001072(dpy-10)|WBGene00001401(fbf-1)|WBGene00001402(fbf-2) | WBGene00001072(dpy-10), WBGene00001401(fbf-1), WBGene00001402(fbf-2) | WB-STRAIN:WBStrain00062704 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:11 | 0 | ||||
|
lrp-1(wrd320[lrp-1::mNG::3xFLAG]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00062660 | Caenorhabditis elegans | lrp-1(wrd320[lrp-1::mNG::3xFLAG]) I. | Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in the last exon of the endogenous lrp-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. | WBGene00003071(lrp-1) | WBGene00003071(lrp-1) | WB-STRAIN:WBStrain00062660 | WormBase (WB) | WB | unknown | WormBase | 2026-10-17 11:49:10 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
