Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
EG8925 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007067 | Caenorhabditis elegans | oxTi986 X. | oxTi986 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-20.67). Insertion into T08D2.2. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection. | WB-STRAIN:WBStrain00007067 | WormBase (WB) | WB | available | WB-STRAIN:EG8925, CGC_EG8925 | WormBase | 2026-09-26 11:22:10 | 0 | |||||
|
EG8919 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007061 | Caenorhabditis elegans | oxTi977 I. | oxTi977 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:2.42). Insertion into T22C1.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection. | WB-STRAIN:WBStrain00007061 | WormBase (WB) | WB | available | WB-STRAIN:EG8919, CGC_EG8919 | WormBase | 2026-09-26 11:22:10 | 0 | |||||
|
EG8918 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007060 | Caenorhabditis elegans | oxTi976 II. | oxTi976 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:0.84). Insertion into D2085.5. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection. | WB-STRAIN:WBStrain00007060 | WormBase (WB) | WB | available | WB-STRAIN:EG8918, CGC_EG8918 | WormBase | 2026-09-26 11:22:10 | 0 | |||||
|
EG8936 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007078 | Caenorhabditis elegans | oxTi997 V. | oxTi997 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:2.06). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection. | WB-STRAIN:WBStrain00007078 | WormBase (WB) | WB | available | WB-STRAIN:EG8936, CGC_EG8936 | WormBase | 2026-09-26 11:22:10 | 0 | |||||
|
EG8934 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007076 | Caenorhabditis elegans | oxTi995 I. | oxTi995 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-0.03). Insertion into pqn-44. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection. | WB-STRAIN:WBStrain00007076 | WormBase (WB) | WB | available | WB-STRAIN:EG8934, CGC_EG8934 | WormBase | 2026-09-26 11:22:10 | 0 | |||||
|
EG8933 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007075 | Caenorhabditis elegans | oxTi994 IV. | oxTi994 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:2.45). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection. | WB-STRAIN:WBStrain00007075 | WormBase (WB) | WB | available | WB-STRAIN:EG8933, CGC_EG8933 | WormBase | 2026-09-26 11:22:10 | 0 | |||||
|
EG8932 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007074 | Caenorhabditis elegans | oxTi993 I. | oxTi993 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:25.92). Insertion into Y105E8B.7. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection. | WB-STRAIN:WBStrain00007074 | WormBase (WB) | WB | available | WB-STRAIN:EG8932, CGC_EG8932 | WormBase | 2026-09-26 11:22:10 | 0 | |||||
|
EG8931 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007073 | Caenorhabditis elegans | oxTi992 II. | oxTi992 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-15.96). Insertion into K10B4.1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection. | WB-STRAIN:WBStrain00007073 | WormBase (WB) | WB | available | WB-STRAIN:EG8931, CGC_EG8931 | WormBase | 2026-09-26 11:22:10 | 0 | |||||
|
EG8929 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007071 | Caenorhabditis elegans | oxTi990 II. | Made_by: C. Frokjaer-Jensen|"no longer available from the CGC."|"oxTi990 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:0.87). Insertion into trcs-2. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection." | WB-STRAIN:WBStrain00007071 | WormBase (WB) | WB | available | WB-STRAIN:EG8929, CGC_EG8929 | WormBase | 2026-09-26 11:22:10 | 0 | |||||
|
EG8862 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007004 | Caenorhabditis elegans | unc-119(ed3) III; oxTi908 V. | oxTi908 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:12.85). Insertion into sri-70. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00007004 | WormBase (WB) | WB | available | WB-STRAIN:EG8862, CGC_EG8862 | WormBase | 2026-09-26 11:22:09 | 0 | |||
|
EG8861 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007003 | Caenorhabditis elegans | unc-119(ed3) III; oxTi907 V. | oxTi907 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:11.98). Insertion into srz-92 (pseudogene). Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00007003 | WormBase (WB) | WB | available | WB-STRAIN:EG8861, CGC_EG8861 | WormBase | 2026-09-26 11:22:09 | 0 | |||
|
EG8860 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007002 | Caenorhabditis elegans | unc-119(ed3) III; oxTi906 V. | oxTi906 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:24.52). Insertion into ttx-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00007002 | WormBase (WB) | WB | available | WB-STRAIN:EG8860, CGC_EG8860 | WormBase | 2026-09-26 11:22:09 | 0 | |||
|
EG8946 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007088 | Caenorhabditis elegans | oxTi1008 IV. | oxTi1008 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:3.75). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection. | WB-STRAIN:WBStrain00007088 | WormBase (WB) | WB | available | WB-STRAIN:EG8946, CGC_EG8946 | WormBase | 2026-09-26 11:22:11 | 0 | |||||
|
EG8944 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007086 | Caenorhabditis elegans | oxTi1006 V. | oxTi1006 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-19.95). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection. | WB-STRAIN:WBStrain00007086 | WormBase (WB) | WB | available | WB-STRAIN:EG8944, CGC_EG8944 | WormBase | 2026-09-26 11:22:10 | 0 | |||||
|
EG8941 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007083 | Caenorhabditis elegans | oxTi1002 I. | oxTi1002 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:19.25). Insertion into Y40B1A.3. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection. | WB-STRAIN:WBStrain00007083 | WormBase (WB) | WB | available | WB-STRAIN:EG8941, CGC_EG8941 | WormBase | 2026-09-26 11:22:10 | 0 | |||||
|
EG8938 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007080 | Caenorhabditis elegans | oxTi999 V. | oxTi999 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:6.72). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection. | WB-STRAIN:WBStrain00007080 | WormBase (WB) | WB | available | WB-STRAIN:EG8938, CGC_EG8938 | WormBase | 2026-09-26 11:22:10 | 0 | |||||
|
EK123 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007131 | Caenorhabditis elegans | cmEx6. | cmEx6 [(pBR126) mbk-2p::GFP + rol-6(su1006)]. Maintain by picking Rollers. | WBGene00003150(mbk-2) | WBGene00003150(mbk-2) | WB-STRAIN:WBStrain00007131 | WormBase (WB) | WB | available | WB-STRAIN:EK123, CGC_EK123 | WormBase | 2026-09-26 11:22:11 | 0 | |||
|
EJ1171 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007130 | Caenorhabditis elegans | gon-2(q388) I; gem-1(bc364) X. | NOTE: Supplement media to 50 mM Mg2+ and grow at 15C for maximum fertility. The stock will propagate on non-supplemented media at 20 degrees, but this will potentially select for intragenic revertants of gon-2(q388). Temperature-sensitive failure of gonad precursor divisions. Penetrance of Gon phenotype is very high at 23.5C. At 25 degrees you can expect reduced brood sizes and some embryonic lethality. [Note: temperature sensitive period for gon-2(q388) begins prior to fertilization.] bc364 deletes 1,109 bp between AACATCTTGAATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAGCTTACATTTAGTA. References: Kemp BJ, et al. Genetics. 2009 Feb;181(2):581-91. Sun AY & Lambie EJ. Genetics. 1997 Nov;147(3):1077-89. | WBGene00001651(gon-2)|WBGene00008214(gem-1) | WBGene00001651(gon-2), WBGene00008214(gem-1) | WB-STRAIN:WBStrain00007130 | WormBase (WB) | WB | available | WB-STRAIN:EJ1171, CGC_EJ1171 | WormBase | 2026-09-26 11:22:11 | 0 | |||
|
EJ1167 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007129 | Caenorhabditis elegans | gem-1(bc364) X. | bc364 deletes 1,109 bp between AACATCTTGAATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAGCTTACATTTAGTA. References: Kemp BJ, et al. Genetics. 2009 Feb;181(2):581-91. | WBGene00008214(gem-1) | WBGene00008214(gem-1) | WB-STRAIN:WBStrain00007129 | WormBase (WB) | WB | available | WB-STRAIN:EJ1167, CGC_EJ1167 | WormBase | 2026-09-26 11:22:11 | 0 | |||
|
EJ810 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00007127 | Caenorhabditis elegans | F25H2.5(ok314)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III; him-8(e1489) IV. | Him. Heterozygotes are WT and segregate WT, Sterile Evul and Dpys.|"Mutagen:UV/TMP" | WBGene00000254(bli-4)|WBGene00001077(dpy-18)|WBGene00001867(him-8)|WBGene00009119(ndk-1) | WBGene00000254(bli-4), WBGene00001077(dpy-18), WBGene00001867(him-8), WBGene00009119(ndk-1) | WB-STRAIN:WBStrain00007127 | WormBase (WB) | WB | available | WB-STRAIN:EJ810, CGC_EJ810 | WormBase | 2026-09-26 11:22:11 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
