Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00007067
Source Database: WormBase (WB)
Availability: available
Synonyms: oxTi986 X.
Alternate IDs: WB-STRAIN:EG8925, CGC_EG8925
Notes: oxTi986 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-20.67). Insertion into T08D2.2. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.
Proper citation: RRID:WB-STRAIN:WBStrain00007067 Copy
http://www.wormbase.org/db/get?name=WBStrain00007061
Source Database: WormBase (WB)
Availability: available
Synonyms: oxTi977 I.
Alternate IDs: WB-STRAIN:EG8919, CGC_EG8919
Notes: oxTi977 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:2.42). Insertion into T22C1.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.
Proper citation: RRID:WB-STRAIN:WBStrain00007061 Copy
http://www.wormbase.org/db/get?name=WBStrain00007060
Source Database: WormBase (WB)
Availability: available
Synonyms: oxTi976 II.
Alternate IDs: WB-STRAIN:EG8918, CGC_EG8918
Notes: oxTi976 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:0.84). Insertion into D2085.5. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.
Proper citation: RRID:WB-STRAIN:WBStrain00007060 Copy
http://www.wormbase.org/db/get?name=WBStrain00007078
Source Database: WormBase (WB)
Availability: available
Synonyms: oxTi997 V.
Alternate IDs: WB-STRAIN:EG8936, CGC_EG8936
Notes: oxTi997 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:2.06). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
Proper citation: RRID:WB-STRAIN:WBStrain00007078 Copy
http://www.wormbase.org/db/get?name=WBStrain00007076
Source Database: WormBase (WB)
Availability: available
Synonyms: oxTi995 I.
Alternate IDs: WB-STRAIN:EG8934, CGC_EG8934
Notes: oxTi995 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-0.03). Insertion into pqn-44. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
Proper citation: RRID:WB-STRAIN:WBStrain00007076 Copy
http://www.wormbase.org/db/get?name=WBStrain00007075
Source Database: WormBase (WB)
Availability: available
Synonyms: oxTi994 IV.
Alternate IDs: WB-STRAIN:EG8933, CGC_EG8933
Notes: oxTi994 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:2.45). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
Proper citation: RRID:WB-STRAIN:WBStrain00007075 Copy
http://www.wormbase.org/db/get?name=WBStrain00007074
Source Database: WormBase (WB)
Availability: available
Synonyms: oxTi993 I.
Alternate IDs: WB-STRAIN:EG8932, CGC_EG8932
Notes: oxTi993 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:25.92). Insertion into Y105E8B.7. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
Proper citation: RRID:WB-STRAIN:WBStrain00007074 Copy
http://www.wormbase.org/db/get?name=WBStrain00007073
Source Database: WormBase (WB)
Availability: available
Synonyms: oxTi992 II.
Alternate IDs: WB-STRAIN:EG8931, CGC_EG8931
Notes: oxTi992 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-15.96). Insertion into K10B4.1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.
Proper citation: RRID:WB-STRAIN:WBStrain00007073 Copy
http://www.wormbase.org/db/get?name=WBStrain00007071
Source Database: WormBase (WB)
Availability: available
Synonyms: oxTi990 II.
Alternate IDs: WB-STRAIN:EG8929, CGC_EG8929
Notes: Made_by: C. Frokjaer-Jensen|"no longer available from the CGC."|"oxTi990 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:0.87). Insertion into trcs-2. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection."
Proper citation: RRID:WB-STRAIN:WBStrain00007071 Copy
http://www.wormbase.org/db/get?name=WBStrain00007004
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: unc-119(ed3) III; oxTi908 V.
Alternate IDs: WB-STRAIN:EG8862, CGC_EG8862
Notes: oxTi908 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:12.85). Insertion into sri-70. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
Proper citation: RRID:WB-STRAIN:WBStrain00007004 Copy
http://www.wormbase.org/db/get?name=WBStrain00007003
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: unc-119(ed3) III; oxTi907 V.
Alternate IDs: WB-STRAIN:EG8861, CGC_EG8861
Notes: oxTi907 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:11.98). Insertion into srz-92 (pseudogene). Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
Proper citation: RRID:WB-STRAIN:WBStrain00007003 Copy
http://www.wormbase.org/db/get?name=WBStrain00007002
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: unc-119(ed3) III; oxTi906 V.
Alternate IDs: WB-STRAIN:EG8860, CGC_EG8860
Notes: oxTi906 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:24.52). Insertion into ttx-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
Proper citation: RRID:WB-STRAIN:WBStrain00007002 Copy
http://www.wormbase.org/db/get?name=WBStrain00007088
Source Database: WormBase (WB)
Availability: available
Synonyms: oxTi1008 IV.
Alternate IDs: WB-STRAIN:EG8946, CGC_EG8946
Notes: oxTi1008 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:3.75). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.
Proper citation: RRID:WB-STRAIN:WBStrain00007088 Copy
http://www.wormbase.org/db/get?name=WBStrain00007086
Source Database: WormBase (WB)
Availability: available
Synonyms: oxTi1006 V.
Alternate IDs: WB-STRAIN:EG8944, CGC_EG8944
Notes: oxTi1006 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-19.95). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
Proper citation: RRID:WB-STRAIN:WBStrain00007086 Copy
http://www.wormbase.org/db/get?name=WBStrain00007083
Source Database: WormBase (WB)
Availability: available
Synonyms: oxTi1002 I.
Alternate IDs: WB-STRAIN:EG8941, CGC_EG8941
Notes: oxTi1002 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:19.25). Insertion into Y40B1A.3. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
Proper citation: RRID:WB-STRAIN:WBStrain00007083 Copy
http://www.wormbase.org/db/get?name=WBStrain00007080
Source Database: WormBase (WB)
Availability: available
Synonyms: oxTi999 V.
Alternate IDs: WB-STRAIN:EG8938, CGC_EG8938
Notes: oxTi999 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:6.72). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
Proper citation: RRID:WB-STRAIN:WBStrain00007080 Copy
http://www.wormbase.org/db/get?name=WBStrain00007131
Source Database: WormBase (WB)
Affected Genes: WBGene00003150(mbk-2)
Genomic Alteration: WBGene00003150(mbk-2)
Availability: available
Synonyms: cmEx6.
Alternate IDs: WB-STRAIN:EK123, CGC_EK123
Notes: cmEx6 [(pBR126) mbk-2p::GFP + rol-6(su1006)]. Maintain by picking Rollers.
Proper citation: RRID:WB-STRAIN:WBStrain00007131 Copy
http://www.wormbase.org/db/get?name=WBStrain00007130
Source Database: WormBase (WB)
Affected Genes: WBGene00001651(gon-2)|WBGene00008214(gem-1)
Genomic Alteration: WBGene00001651(gon-2), WBGene00008214(gem-1)
Availability: available
Synonyms: gon-2(q388) I; gem-1(bc364) X.
Alternate IDs: WB-STRAIN:EJ1171, CGC_EJ1171
Notes: NOTE: Supplement media to 50 mM Mg2+ and grow at 15C for maximum fertility. The stock will propagate on non-supplemented media at 20 degrees, but this will potentially select for intragenic revertants of gon-2(q388). Temperature-sensitive failure of gonad precursor divisions. Penetrance of Gon phenotype is very high at 23.5C. At 25 degrees you can expect reduced brood sizes and some embryonic lethality. [Note: temperature sensitive period for gon-2(q388) begins prior to fertilization.] bc364 deletes 1,109 bp between AACATCTTGAATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAGCTTACATTTAGTA. References: Kemp BJ, et al. Genetics. 2009 Feb;181(2):581-91. Sun AY & Lambie EJ. Genetics. 1997 Nov;147(3):1077-89.
Proper citation: RRID:WB-STRAIN:WBStrain00007130 Copy
http://www.wormbase.org/db/get?name=WBStrain00007129
Source Database: WormBase (WB)
Affected Genes: WBGene00008214(gem-1)
Genomic Alteration: WBGene00008214(gem-1)
Availability: available
Synonyms: gem-1(bc364) X.
Alternate IDs: WB-STRAIN:EJ1167, CGC_EJ1167
Notes: bc364 deletes 1,109 bp between AACATCTTGAATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAGCTTACATTTAGTA. References: Kemp BJ, et al. Genetics. 2009 Feb;181(2):581-91.
Proper citation: RRID:WB-STRAIN:WBStrain00007129 Copy
http://www.wormbase.org/db/get?name=WBStrain00007127
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001077(dpy-18)|WBGene00001867(him-8)|WBGene00009119(ndk-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001077(dpy-18), WBGene00001867(him-8), WBGene00009119(ndk-1)
Availability: available
Synonyms: F25H2.5(ok314)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III; him-8(e1489) IV.
Alternate IDs: WB-STRAIN:EJ810, CGC_EJ810
Notes: Him. Heterozygotes are WT and segregate WT, Sterile Evul and Dpys.|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00007127 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.