Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00023455

Source Database: WormBase (WB)
Affected Genes: WBGene00002987(lim-4)
Genomic Alteration: WBGene00002987(lim-4)
Availability: available
Source References: PMID:37258276, PMID:37587694, PMID:38362034
Synonyms: lim-4(yz12) X.
Alternate IDs: WB-STRAIN:JY359, CGC_JY359
Notes: Down regulation of tph-1::GFP expression in the ADF neurons.|"Supplementary_genotype lim-4(yz12)"

Proper citation: RRID:WB-STRAIN:WBStrain00023455 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00023448

Source Database: WormBase (WB)
Affected Genes: WBGene00006344(sup-39)
Genomic Alteration: WBGene00006344(sup-39)
Availability: available
Source References: PMID:8722777
Synonyms: sup-39(je5) II.
Alternate IDs: WB-STRAIN:JW102, CGC_JW102
Notes: je5 is a dominant suppressor of unc-73(e936). WT movement. Various degrees of embryonic lethality and Egl. About 1% Roller after L4.

Proper citation: RRID:WB-STRAIN:WBStrain00023448 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00023445

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:38301974, PMID:38669260
Synonyms: unc-119(ed3) III; jrIs2.
Alternate IDs: WB-STRAIN:JV2, CGC_JV2
Notes: jrIs2 [rpl-17p::Grx1-roGFP2 + unc-119(+)]. Stable transgene ubiquituously expressing the roGFP2 sensor under a ribosomal promoter for in vivo estimation of GSSG/2GSH ratios. Reference: Back P, et al. Free Radic Biol Med. 2012 Mar 1;52(5):850-9.|"Made_by: Back & Braeckman"

Proper citation: RRID:WB-STRAIN:WBStrain00023445 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00023446

Source Database: WormBase (WB)
Affected Genes: WBGene00003171(mec-7)|WBGene00004397(rol-6)
Genomic Alteration: WBGene00003171(mec-7), WBGene00004397(rol-6)
Availability: available
Source References: PMID:1639062
Synonyms: jeIs1I.
Alternate IDs: WB-STRAIN:JW29, CGC_JW29
Notes: jeIs1 [mec-7(+)::lacZ + rol-6(su1006)]. Rollers. Males will mate.|"Mutagen:Gamma rays"

Proper citation: RRID:WB-STRAIN:WBStrain00023446 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00023443

Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)
Genomic Alteration: WBGene00001867(him-8)
Availability: available
Synonyms: oxSi120 II; him-8(e1489) IV.
Alternate IDs: WB-STRAIN:JUP1, CGC_JUP1
Notes: oxSi120 [peel-1p::tagRFP::MSP-142 3'utr+ unc-119(+)]. Him. Derived from EG5897 and CB1489; not known if is unc-119(ed3) is still present in background. Reference: Batchelder EL, et al. Proc Natl Acad Sci U S A. 2011 Jul 12;108(28):11429-34.

Proper citation: RRID:WB-STRAIN:WBStrain00023443 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00023475

Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00004117(sin-3)
Genomic Alteration: WBGene00001864(him-5), WBGene00004117(sin-3)
Availability: available
Source References: PMID:31397537
Synonyms: sin-3(tm1276) I; him-5(e1490) V.
Alternate IDs: WB-STRAIN:KC565, CGC_KC565
Notes: Mab. Pvl. Throws males.|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00023475 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00023479

Source Database: WormBase (WB)
Affected Genes: WBGene00000068(acy-1)
Genomic Alteration: WBGene00000068(acy-1)
Availability: available
Source References: PMID:34037773
Synonyms: acy-1(ce2) III.
Alternate IDs: WB-STRAIN:KG518, CGC_KG518
Notes: About normal size and distribution on food. Hyperactive locomotion. Hypersensitive to stimuli. Most mature adults have slight vulval bump. Not obviously Egl-d or Egl-c. Dominant, gain-of-function allele. Mutation is P260S. Sequence in WT: CAGTCTGTGATG C CT. Sequence in ce2: CAGTCTGTGATG T CT.|"WBStrain mapped, WBPaper00060924 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061459 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00023479 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00023471

Source Database: WormBase (WB)
Affected Genes: WBGene00003295(mir-67)|WBGene00003311(mir-83)
Genomic Alteration: WBGene00003295(mir-67), WBGene00003311(mir-83)
Availability: available
Synonyms: mir-67(n4899) III; mir-83(n4638) IV.
Alternate IDs: WB-STRAIN:KB12, CGC_KB12
Notes: Combination mutant made with 6x outcrossed lines KB10 mir-67(n4899) and KB11 mir-83(n4638).|"Made_by: Bennett Lab"|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00023471 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00023469

Source Database: WormBase (WB)
Affected Genes: WBGene00003295(mir-67)
Genomic Alteration: WBGene00003295(mir-67)
Availability: available
Synonyms: mir-67(n4899) III.
Alternate IDs: WB-STRAIN:KB10, CGC_KB10
Notes: Made_by: Horvitz Lab|"MT15982 mir-67(n4899) was outcrossed 6x to produce this strain. Deletion breakpoints are:GGGTGCCTAATGCAAA / AGTACACATTTATGAAT...GCGAGTTTAAAGCAACG / AGTAGCAGAAGGACCA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00023469 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00023463

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: unc-119(ed3) III; seaEx13.
Alternate IDs: WB-STRAIN:KAE28, CGC_KAE28
Notes: seaEx13 [fmo-2p::GFP + unc-119(+)]. Pick non-Unc to maintain. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8.

Proper citation: RRID:WB-STRAIN:WBStrain00023463 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00023461

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: seaSi40 I; unc-119(ed3) III.
Alternate IDs: WB-STRAIN:KAE10, CGC_KAE10
Notes: Made_by: Scott Leiser|"seaSi40 [(pCFJ448) (eft-3p::fmo-2 + H2B::GFP) + Cbr-unc-119(+)] I. Higher level of FMO-2 over-expression compared to KAE9. Improved healthspan, stress resistance and longevity. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8."|"seaSi40 [(pCFJ448) eft-3p::fmo-2 GFP + Cbr-unc-119(+)] I. Higher level of FMO-2 over-expression compared to KAE9. Improved healthspan, stress resistance and longevity. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8."

Proper citation: RRID:WB-STRAIN:WBStrain00023461 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00023462

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: seaSi182 II; unc-119(ed3) III.
Alternate IDs: WB-STRAIN:KAE12, CGC_KAE12
Notes: seaSi182 [(pCFJ150) (vha-6p::fmo-2 + H2B::GFP) + Cbr-unc-119(+)] II. Over-expression of FMO-2 in the intestine. Long-lived. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8.|"seaSi182 [(pCFJ150) vha-6p::fmo-2::GFP + Cbr-unc-119(+)] II. Over-expression of FMO-2 in the intestine. Long-lived. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8."

Proper citation: RRID:WB-STRAIN:WBStrain00023462 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00023468

Source Database: WormBase (WB)
Affected Genes: WBGene00002187(kgb-1)|WBGene00002188(kgb-2)
Genomic Alteration: WBGene00002187(kgb-1), WBGene00002188(kgb-2)
Availability: available
Synonyms: kgb-1(um3) kgb-2(km16) IV.
Alternate IDs: WB-STRAIN:KB7, CGC_KB7
Notes: Deletion alleles. Can be maintained at 20C. Sterile at 26C. Can use PCR with the following primer to determine whether both deletions are present. (5'end)5'GGTCTACCAGAGTTTGTGCGCAATC3' (3'end)5'GATAGCCTTGCACTTCGTTG3'. PCR products from wild type show two bands; kgb-1 gene shows a smaller band; kgb-2 gene shows a bigger band.The double mutant should have no PCR product. [NOTE: The 5' primer sequence was corrected 03/28/12 (K. Bennett)]|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00023468 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00023465

Source Database: WormBase (WB)
Affected Genes: WBGene00002187(kgb-1)
Genomic Alteration: WBGene00002187(kgb-1)
Availability: available
Source References: PMID:33674585, PMID:37310929, PMID:38573858
Synonyms: kgb-1(um3) IV.
Alternate IDs: WB-STRAIN:KB3, CGC_KB3
Notes: Mutagen:UV/Psoralen|"Temperature sensitive sterile at 26C, with EMO oocytes. Grows at 15C or 20C."

Proper citation: RRID:WB-STRAIN:WBStrain00023465 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00023466

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001598(glh-1)|WBGene00001601(glh-4)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001598(glh-1), WBGene00001601(glh-4)
Availability: available
Synonyms: glh-4(gk225) glh-1(ok439) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:KB4, CGC_KB4
Notes: Made_by: Chris Yee|"Mutagen:UV/TMP"|"Pick GFP+ to maintain balanced stock. Heterozygotes are superficially wild-type GFP+ and segregate wild-type GFP+ (heterozygotes), arrested hT2 aneuploids, and non-GFP glh-4 glh-1 homozygotes (sterile; incompletely penetrant). NOTE (K. Bennett, 2012): KB4 strain is only 63% sterile at 20C and 92% sterile at 26C (Spike et al., Genetics 2008 178:1973). glh-1(ok439) is not a null allele."

Proper citation: RRID:WB-STRAIN:WBStrain00023466 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00023497

Source Database: WormBase (WB)
Availability: available
Source References: PMID:30254025
Synonyms: ceIs269 I.
Alternate IDs: WB-STRAIN:KG4687, CGC_KG4687
Notes: ceIs269 [unc-129p::tomm-20::Venus + unc-129p::mCherry + ttx-3p::RFP]; Integration in Chromosome I (near genetic position -3.20 or 1.14). The ttx-3 marker is quite faint in this strain especially in larvae. The tomm-20::Venus construct was injected at 0.5 ng/ ul in the strain used to make this integrant, so virtually all of the visible tomm-20::Venus signal s associated with mitochondria with essentially no background. The unc-129p::mCherry marker is expressed at a very low level that are detectable only with a sensitive camera (and often not by eye at 1000X). In strains lacking mitochondria in the dorsal cord, use the camera to focus on the mCherry in the dorsal cord, then acquire in the YFP channel.|"Made_by: Logan Morrison"|"Mutagen:Gamma Rays"

Proper citation: RRID:WB-STRAIN:WBStrain00023497 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00023494

Source Database: WormBase (WB)
Affected Genes: WBGene00004719(sad-1)
Genomic Alteration: WBGene00004719(sad-1)
Availability: available
Synonyms: sad-1(ce749) X.
Alternate IDs: WB-STRAIN:KG4400, CGC_KG4400
Notes: Superficially wild-type on plates. Shows defects in the transport and capture of dense core vesicles and synaptic vesicles in cholinergic motor neurons. Suppresses organelle accumulation (lysosomes, early endosomes, Golgi) in axons in an unc-16(-) background. Reference: Edwards SL, et al. Genetics. 2015 Sep;201(1):91-116. Edwards SL, et al. Genetics. 2015 Sep;201(1):117-41.

Proper citation: RRID:WB-STRAIN:WBStrain00023494 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00023498

Source Database: WormBase (WB)
Affected Genes: WBGene00006840(unc-116)|WBGene00012759(sup-1)
Genomic Alteration: WBGene00006840(unc-116), WBGene00012759(sup-1)
Availability: available
Source References: PMID:30254025
Synonyms: unc-116(ce815[LoxP+sup-1(e995)+LoxP]) III.
Alternate IDs: WB-STRAIN:KG4731, CGC_KG4731
Notes: Lox P sites in 3' UTR and 4th intron flank kinesin motor domain sequences; sup-1(e995) mini-gene inserted in second intron. Appears wild-type on plates and in quantitative locomotion assays. Can be used to conditionally delete gene sequences encoding the conventional kinesin motor domain in a tissue specific manner by driving expression of Cre recombinase in the tissue of interest. Reference: Stec N, et al. (Submitted). An Intron Compatible Marker for Long Distance CRISPR Mediated Gene Editing in Caenorhabditis elegans.

Proper citation: RRID:WB-STRAIN:WBStrain00023498 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00023492

Source Database: WormBase (WB)
Availability: available
Synonyms: ceIs201 I.
Alternate IDs: WB-STRAIN:KG4247, CGC_KG4247
Notes: ceIs201 [unc-17p::ins-22::Venus + unc-17p::RFP + unc-17p::ssmCherry + myo-2p::RFP]; integration site maps to I:0.77. Expresses INS-22::Venus to mark Dense Core Vesicles in the cholinergic nervous system, including the ventral cord cholinergic motor neurons. Also expresses mCherry in the same neurons to help identify the boundaries of the somas, axons, and dendrites. ssmCherry is mCherry with a secretion signal on its N-terminus, which is constitutively secreted and taken up by coelomoctyes in the pseuodcoelomic space, making it a useful marker for those coelomocytes. The INS-22::Venus also gets secreted by DCVs and taken up by coelomocytes. The myo-2::RFP is a co-tranformation marker that lights up the pharyngeal muscle cells and is useful for crossing the integrant into various mutant backgrounds. Reference: Hoover CM, et al. Genetics. 2014 Mar;196(3):745-65.|"Mutagen:Gamma Rays"

Proper citation: RRID:WB-STRAIN:WBStrain00023492 Copy   

•   Source: WormBase
  

http://www.wormbase.org/db/get?name=WBStrain00023491

Source Database: WormBase (WB)
Affected Genes: WBGene00000550(clu-1)
Genomic Alteration: WBGene00000550(clu-1)
Availability: available
Synonyms: clu-1(ok3).
Alternate IDs: WB-STRAIN:KG2731, CGC_KG2731
Notes: Made_by: R Barstead/M Clarke|"Mild locomotory defects, sluggish response to physical stimuli, and reduced thrashing rate. Phenotype less severe than ok2. ok3 is a 1047 bp deletion (III:9518654-9519699) and 13 nucleotude insertion (producing two termination codons) resulting in a protein truncated at amino acid 693 plus an inserted glutamic acid. Flanking sequence: GCTCGAGGATGCTGCTCACAAACTGAAAATG...GAATAGTATCCGTGAATAGTATCCG TGAAGATTCTG."|"Mild locomotory defects, sluggish response to physical stimuli, and reduced thrashing rate. Phenotype less severe than ok2. ok3 is a 1047 bp deletion (III:9518654-9519699) and 13 nucleotude insertion (producing two termination codons) resulting in a protein truncated at amino acid 693 plus an inserted glutamic acid. Flanking sequence: GCTCGAGGATGCTGCTCACAAACTGAAAATG...GAATAGTATCCGTGAATAGTATCCGTGAAGATTCTG."|"Mutagen:UV-Psoralen"

Proper citation: RRID:WB-STRAIN:WBStrain00023491 Copy   

•   Source: WormBase